Mutagenetix > Incidental Mutation

Incidental Mutation 'R2986:Gss'

257798

Institutional Source

Beutler Lab

Gene Symbol

Gss

Ensembl Gene

ENSMUSG00000027610

Gene Name

glutathione synthetase

Synonyms

GS-A/GS-B

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2986 (G1)

Quality Score

137

Status

Not validated

Chromosome

Chromosomal Location

155405101-155434730 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 155429363 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 43 (D43G)

Ref Sequence

ENSEMBL: ENSMUSP00000078630 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065973] [ENSMUST00000079691] [ENSMUST00000126322] [ENSMUST00000130881] [ENSMUST00000155347]

AlphaFold

P51855

Predicted Effect

probably benign
Transcript: ENSMUST00000065973

SMART Domains

Protein: ENSMUSP00000068776
Gene: ENSMUSG00000027605

Domain	Start	End	E-Value	Type
Pfam:AMP-binding	108	575	4.8e-98	PFAM
Pfam:AMP-binding_C	583	660	3.1e-21	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000079691
AA Change: D43G

PolyPhen 2 Score 0.213 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000078630
Gene: ENSMUSG00000027610
AA Change: D43G

Domain	Start	End	E-Value	Type
Pfam:GSH_synth_ATP	12	472	6.7e-131	PFAM
Pfam:GSH_synthase	204	302	2.5e-36	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000126322

SMART Domains

Protein: ENSMUSP00000117266
Gene: ENSMUSG00000027610

Domain	Start	End	E-Value	Type
Pfam:GSH_synth_ATP	1	197	1.2e-63	PFAM
Pfam:GSH_synthase	160	200	3.1e-12	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130859

Predicted Effect

probably benign
Transcript: ENSMUST00000130881

SMART Domains

Protein: ENSMUSP00000135319
Gene: ENSMUSG00000027610

Domain	Start	End	E-Value	Type
Pfam:GSH_synth_ATP	1	404	9.2e-130	PFAM
Pfam:GSH_synthase	133	233	9e-38	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137305

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142509

Predicted Effect

probably benign
Transcript: ENSMUST00000155347
AA Change: D43G

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000122662
Gene: ENSMUSG00000027610
AA Change: D43G

Domain	Start	End	E-Value	Type
Pfam:GSH_synth_ATP	5	179	1.8e-64	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000157008

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176415

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153975

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155884

Coding Region Coverage

1x: 99.4%
3x: 98.6%
10x: 97.1%
20x: 94.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Glutathione is important for a variety of biological functions, including protection of cells from oxidative damage by free radicals, detoxification of xenobiotics, and membrane transport. The protein encoded by this gene functions as a homodimer to catalyze the second step of glutathione biosynthesis, which is the ATP-dependent conversion of gamma-L-glutamyl-L-cysteine to glutathione. Defects in this gene are a cause of glutathione synthetase deficiency. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation all die before E7.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 16 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
AI661453	T	A	17: 47,777,697 (GRCm39)	C474*	probably null	Het
Arhgap18	A	G	10: 26,730,903 (GRCm39)	T122A	probably benign	Het
Bahd1	G	A	2: 118,753,004 (GRCm39)	R757H	probably damaging	Het
Bbs4	A	G	9: 59,248,478 (GRCm39)	L75P	probably damaging	Het
Bltp3b	T	A	10: 89,641,931 (GRCm39)	V1034E	probably benign	Het
Cenpl	C	T	1: 160,911,037 (GRCm39)		probably benign	Het
Cnnm4	G	A	1: 36,511,453 (GRCm39)	R227H	possibly damaging	Het
Dipk2a	C	A	9: 94,402,570 (GRCm39)	C364F	probably damaging	Het
Eif4g2	T	C	7: 110,677,690 (GRCm39)	E141G	probably damaging	Het
Fat3	A	G	9: 15,903,424 (GRCm39)	C3024R	probably damaging	Het
Hmcn2	A	T	2: 31,251,010 (GRCm39)	D824V	probably damaging	Het
Slc15a1	C	T	14: 121,727,221 (GRCm39)	D116N	probably benign	Het
Slc34a1	A	G	13: 55,551,142 (GRCm39)	D190G	probably benign	Het
Ttll11	G	A	2: 35,707,750 (GRCm39)	S519L	probably benign	Het
Wdr49	T	C	3: 75,289,347 (GRCm39)	M184V	probably benign	Het
Zfp384	T	A	6: 125,001,859 (GRCm39)	V113E	possibly damaging	Het

Other mutations in Gss

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00959:Gss	APN	2	155,423,871 (GRCm39)	missense	probably damaging	1.00
IGL01737:Gss	APN	2	155,409,726 (GRCm39)	missense	probably damaging	1.00
IGL01783:Gss	APN	2	155,413,479 (GRCm39)	missense	probably damaging	1.00
IGL02329:Gss	APN	2	155,409,773 (GRCm39)	missense	probably benign	0.01
IGL02386:Gss	APN	2	155,415,090 (GRCm39)	missense	probably benign	0.01
IGL02948:Gss	APN	2	155,419,541 (GRCm39)	missense	probably damaging	1.00
PIT4515001:Gss	UTSW	2	155,420,261 (GRCm39)	missense	probably damaging	1.00
R0230:Gss	UTSW	2	155,420,326 (GRCm39)	missense	probably damaging	1.00
R0446:Gss	UTSW	2	155,409,665 (GRCm39)	missense	probably benign	0.00
R0931:Gss	UTSW	2	155,409,609 (GRCm39)	intron	probably benign
R1396:Gss	UTSW	2	155,409,641 (GRCm39)	missense	probably damaging	0.99
R2896:Gss	UTSW	2	155,406,749 (GRCm39)	missense	probably damaging	1.00
R4852:Gss	UTSW	2	155,406,785 (GRCm39)	missense	probably benign	0.06
R5148:Gss	UTSW	2	155,415,029 (GRCm39)	missense	possibly damaging	0.80
R6017:Gss	UTSW	2	155,429,385 (GRCm39)	missense	probably benign
R6574:Gss	UTSW	2	155,423,931 (GRCm39)	missense	probably damaging	1.00
R6868:Gss	UTSW	2	155,409,732 (GRCm39)	missense	possibly damaging	0.69
R8274:Gss	UTSW	2	155,429,424 (GRCm39)	missense	probably benign	0.00
R8510:Gss	UTSW	2	155,409,744 (GRCm39)	nonsense	probably null
R8801:Gss	UTSW	2	155,406,686 (GRCm39)	missense	probably damaging	1.00
R8903:Gss	UTSW	2	155,420,279 (GRCm39)	missense	probably damaging	0.99
R9038:Gss	UTSW	2	155,406,794 (GRCm39)	missense

Predicted Primers

PCR Primer
(F):5'- CTTACGGAAATTAAGTAGCTGCC -3'
(R):5'- TCACAATGTTGGAAGTAGCCAC -3'

Sequencing Primer
(F):5'- GTAGCTGCCTAAATTACACTTCAAAC -3'
(R):5'- CACAATGTTGGAAGTAGCCACATTTG -3'

Posted On

2015-01-11