Mutagenetix > Incidental Mutation

Incidental Mutation 'R2986:Eif4g2'

257800

Institutional Source

Beutler Lab

Gene Symbol

Eif4g2

Ensembl Gene

ENSMUSG00000005610

Gene Name

eukaryotic translation initiation factor 4, gamma 2

Synonyms

DAP-5, Nat1, E130105L11Rik, Natm1

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2986 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

110667192-110682237 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 110677690 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 141 (E141G)

Ref Sequence

ENSEMBL: ENSMUSP00000125375 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000159305] [ENSMUST00000160132] [ENSMUST00000160966] [ENSMUST00000161051] [ENSMUST00000162415]

AlphaFold

no structure available at present

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000158323

Predicted Effect

probably benign
Transcript: ENSMUST00000159305

SMART Domains

Protein: ENSMUSP00000125098
Gene: ENSMUSG00000005610

Domain	Start	End	E-Value	Type
low complexity region	8	25	N/A	INTRINSIC
Blast:MIF4G	32	83	4e-22	BLAST
SCOP:d1hu3a_	67	102	9e-13	SMART
PDB:4IUL\|B	70	102	3e-15	PDB

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159465

Predicted Effect

probably damaging
Transcript: ENSMUST00000160132
AA Change: E141G

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000124914
Gene: ENSMUSG00000005610
AA Change: E141G

Domain	Start	End	E-Value	Type
low complexity region	8	25	N/A	INTRINSIC
low complexity region	61	69	N/A	INTRINSIC
Pfam:MIF4G	78	152	1.3e-19	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160552

Predicted Effect

probably benign
Transcript: ENSMUST00000160966

Predicted Effect

probably damaging
Transcript: ENSMUST00000161051
AA Change: E141G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000125375
Gene: ENSMUSG00000005610
AA Change: E141G

Domain	Start	End	E-Value	Type
low complexity region	8	25	N/A	INTRINSIC
low complexity region	61	69	N/A	INTRINSIC
MIF4G	78	308	2.08e-58	SMART
MA3	505	618	4.76e-35	SMART
low complexity region	634	646	N/A	INTRINSIC
low complexity region	682	704	N/A	INTRINSIC
low complexity region	760	771	N/A	INTRINSIC
eIF5C	775	861	5.43e-34	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000162415
AA Change: E141G

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000124551
Gene: ENSMUSG00000005610
AA Change: E141G

Domain	Start	End	E-Value	Type
low complexity region	8	25	N/A	INTRINSIC
low complexity region	61	69	N/A	INTRINSIC
MIF4G	78	308	2.08e-58	SMART
low complexity region	441	453	N/A	INTRINSIC
Blast:MIF4G	454	490	4e-14	BLAST
MA3	543	656	4.76e-35	SMART
low complexity region	672	684	N/A	INTRINSIC
low complexity region	720	742	N/A	INTRINSIC
low complexity region	798	809	N/A	INTRINSIC
eIF5C	813	899	5.43e-34	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161682

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161790

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161736

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161158

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000209597

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162394

Predicted Effect

probably benign
Transcript: ENSMUST00000163014

SMART Domains

Protein: ENSMUSP00000123811
Gene: ENSMUSG00000005610

Domain	Start	End	E-Value	Type
low complexity region	25	36	N/A	INTRINSIC
Pfam:W2	52	122	2.2e-12	PFAM

Coding Region Coverage

1x: 99.4%
3x: 98.6%
10x: 97.1%
20x: 94.3%

Validation Efficiency

MGI Phenotype

FUNCTION: Translation initiation is mediated by specific recognition of the cap structure by eukaryotic translation initiation factor 4F (eIF4F), which is a cap binding protein complex that consists of three subunits: eIF4A, eIF4E and eIF4G. The protein encoded by this gene shares similarity with the C-terminal region of eIF4G, that contains the binding sites for eIF4A and eIF3; eIF4G in addition, contains a binding site for eIF4E at the N-terminus. Unlike eIF4G which supports cap-dependent and independent translation, this gene product functions as a general repressor of translation by forming translationally inactive complexes. Transgene expression of the apolipoprotein B mRNA-editing enzyme (APOBEC-1) causes extensive editing of this mRNA, which could contribute to the potent oncogenesis induced by overexpression of APOBEC-1. In vitro and in vivo studies in human indicate that translation of this mRNA initiates exclusively at a non-AUG (GUG) codon. This also appears to be true for mouse. Two alternatively spliced transcript variants that encode different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation fail to undergo gastrulation and die by E11.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 16 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
AI661453	T	A	17: 47,777,697 (GRCm39)	C474*	probably null	Het
Arhgap18	A	G	10: 26,730,903 (GRCm39)	T122A	probably benign	Het
Bahd1	G	A	2: 118,753,004 (GRCm39)	R757H	probably damaging	Het
Bbs4	A	G	9: 59,248,478 (GRCm39)	L75P	probably damaging	Het
Bltp3b	T	A	10: 89,641,931 (GRCm39)	V1034E	probably benign	Het
Cenpl	C	T	1: 160,911,037 (GRCm39)		probably benign	Het
Cnnm4	G	A	1: 36,511,453 (GRCm39)	R227H	possibly damaging	Het
Dipk2a	C	A	9: 94,402,570 (GRCm39)	C364F	probably damaging	Het
Fat3	A	G	9: 15,903,424 (GRCm39)	C3024R	probably damaging	Het
Gss	T	C	2: 155,429,363 (GRCm39)	D43G	probably benign	Het
Hmcn2	A	T	2: 31,251,010 (GRCm39)	D824V	probably damaging	Het
Slc15a1	C	T	14: 121,727,221 (GRCm39)	D116N	probably benign	Het
Slc34a1	A	G	13: 55,551,142 (GRCm39)	D190G	probably benign	Het
Ttll11	G	A	2: 35,707,750 (GRCm39)	S519L	probably benign	Het
Wdr49	T	C	3: 75,289,347 (GRCm39)	M184V	probably benign	Het
Zfp384	T	A	6: 125,001,859 (GRCm39)	V113E	possibly damaging	Het

Other mutations in Eif4g2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01302:Eif4g2	APN	7	110,673,920 (GRCm39)	missense	possibly damaging	0.91
IGL01402:Eif4g2	APN	7	110,676,234 (GRCm39)	missense	possibly damaging	0.94
IGL02502:Eif4g2	APN	7	110,680,748 (GRCm39)	missense	probably damaging	0.98
IGL02538:Eif4g2	APN	7	110,678,523 (GRCm39)	missense	probably benign	0.03
IGL02717:Eif4g2	APN	7	110,677,320 (GRCm39)	missense	probably benign	0.45
R0547:Eif4g2	UTSW	7	110,677,500 (GRCm39)	missense	probably damaging	1.00
R0614:Eif4g2	UTSW	7	110,676,430 (GRCm39)	critical splice donor site	probably null
R1351:Eif4g2	UTSW	7	110,673,287 (GRCm39)	missense	probably damaging	1.00
R1764:Eif4g2	UTSW	7	110,673,694 (GRCm39)	missense	probably damaging	1.00
R2009:Eif4g2	UTSW	7	110,673,405 (GRCm39)	missense	probably benign	0.01
R2318:Eif4g2	UTSW	7	110,673,065 (GRCm39)	missense	possibly damaging	0.78
R2382:Eif4g2	UTSW	7	110,674,253 (GRCm39)	missense	probably benign	0.00
R4012:Eif4g2	UTSW	7	110,673,358 (GRCm39)	missense	possibly damaging	0.86
R4592:Eif4g2	UTSW	7	110,677,509 (GRCm39)	missense	probably damaging	1.00
R4785:Eif4g2	UTSW	7	110,676,003 (GRCm39)	missense	probably damaging	0.99
R5037:Eif4g2	UTSW	7	110,676,239 (GRCm39)	missense	probably benign	0.03
R5627:Eif4g2	UTSW	7	110,673,446 (GRCm39)	missense	probably benign	0.32
R5988:Eif4g2	UTSW	7	110,676,437 (GRCm39)	missense	probably benign	0.11
R6229:Eif4g2	UTSW	7	110,676,920 (GRCm39)	splice site	probably null
R8122:Eif4g2	UTSW	7	110,677,760 (GRCm39)	missense	possibly damaging	0.93
R8218:Eif4g2	UTSW	7	110,673,639 (GRCm39)	missense	possibly damaging	0.62
R8711:Eif4g2	UTSW	7	110,673,127 (GRCm39)	missense	probably damaging	1.00
R8726:Eif4g2	UTSW	7	110,676,629 (GRCm39)	missense	probably damaging	1.00
R9156:Eif4g2	UTSW	7	110,672,969 (GRCm39)	missense
R9216:Eif4g2	UTSW	7	110,673,415 (GRCm39)	missense	probably benign	0.08
R9277:Eif4g2	UTSW	7	110,674,066 (GRCm39)	missense	probably damaging	0.98
R9334:Eif4g2	UTSW	7	110,674,031 (GRCm39)	missense	possibly damaging	0.85

Predicted Primers

PCR Primer
(F):5'- TTGGAAATCAAGAGGCGTCTG -3'
(R):5'- TGACTACCACAGAGTTGGATCC -3'

Sequencing Primer
(F):5'- TCAAGAGGCGTCTGAATGTC -3'
(R):5'- ACATGAGATCTAGTCTATTGTACCAG -3'

Posted On

2015-01-11