Incidental Mutation 'R2986:1190002N15Rik'
List |< first << previous [record 8 of 18487] next >> last >|
ID257803
Institutional Source Beutler Lab
Gene Symbol 1190002N15Rik
Ensembl Gene ENSMUSG00000045414
Gene NameRIKEN cDNA 1190002N15 gene
SynonymsGoPro49
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.233) question?
Stock #R2986 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location94517864-94538081 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 94520517 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 364 (C364F)
Ref Sequence ENSEMBL: ENSMUSP00000108651 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113028]
Predicted Effect probably damaging
Transcript: ENSMUST00000113028
AA Change: C364F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108651
Gene: ENSMUSG00000045414
AA Change: C364F

DomainStartEndE-ValueType
low complexity region 7 38 N/A INTRINSIC
low complexity region 97 113 N/A INTRINSIC
Pfam:PIP49_C 206 405 2e-56 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 16 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI661453 T A 17: 47,466,772 C474* probably null Het
Arhgap18 A G 10: 26,854,907 T122A probably benign Het
Bahd1 G A 2: 118,922,523 R757H probably damaging Het
Bbs4 A G 9: 59,341,195 L75P probably damaging Het
Cenpl C T 1: 161,083,467 probably benign Het
Cnnm4 G A 1: 36,472,372 R227H possibly damaging Het
Eif4g2 T C 7: 111,078,483 E141G probably damaging Het
Fat3 A G 9: 15,992,128 C3024R probably damaging Het
Gss T C 2: 155,587,443 D43G probably benign Het
Hmcn2 A T 2: 31,360,998 D824V probably damaging Het
Slc15a1 C T 14: 121,489,809 D116N probably benign Het
Slc34a1 A G 13: 55,403,329 D190G probably benign Het
Ttll11 G A 2: 35,817,738 S519L probably benign Het
Uhrf1bp1l T A 10: 89,806,069 V1034E probably benign Het
Wdr49 T C 3: 75,382,040 M184V probably benign Het
Zfp384 T A 6: 125,024,896 V113E possibly damaging Het
Other mutations in 1190002N15Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01925:1190002N15Rik APN 9 94520456 missense probably damaging 1.00
R0153:1190002N15Rik UTSW 9 94524480 missense probably benign 0.17
R2109:1190002N15Rik UTSW 9 94524445 missense probably damaging 0.99
R4623:1190002N15Rik UTSW 9 94520398 missense possibly damaging 0.48
R4677:1190002N15Rik UTSW 9 94520404 missense probably damaging 1.00
R4705:1190002N15Rik UTSW 9 94520635 missense possibly damaging 0.68
R4876:1190002N15Rik UTSW 9 94537577 missense probably damaging 0.99
R4994:1190002N15Rik UTSW 9 94537433 missense probably benign 0.06
R5322:1190002N15Rik UTSW 9 94520562 missense probably benign 0.00
R5425:1190002N15Rik UTSW 9 94537692 missense probably damaging 0.99
R5739:1190002N15Rik UTSW 9 94520541 missense possibly damaging 0.84
R6788:1190002N15Rik UTSW 9 94524449 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- CCTCACATTGTGACTTAACTGTGC -3'
(R):5'- AATGGGATGCTCTGTATGAGAACG -3'

Sequencing Primer
(F):5'- GTGACTTAACTGTGCCAGATAGCC -3'
(R):5'- TGCTCTGTATGAGAACGTTAGGAAG -3'
Posted On2015-01-11