Mutagenetix > Incidental Mutation

Incidental Mutation 'R2987:Sumf2'

257817

Institutional Source

Beutler Lab

Gene Symbol

Sumf2

Ensembl Gene

ENSMUSG00000025538

Gene Name

sulfatase modifying factor 2

Synonyms

2610040F05Rik

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.098) question?

Stock #

R2987 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

129875807-129892275 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 129875925 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 30 (L30P)

Ref Sequence

ENSEMBL: ENSMUSP00000126036 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000137357] [ENSMUST00000171300] [ENSMUST00000201874]

AlphaFold

Q8BPG6

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000031402

SMART Domains

Protein: ENSMUSP00000031402
Gene: ENSMUSG00000029447

Domain	Start	End	E-Value	Type
low complexity region	11	21	N/A	INTRINSIC
Pfam:Cpn60_TCP1	30	527	9.9e-153	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000137357
AA Change: L21P

SMART Domains

Protein: ENSMUSP00000144155
Gene: ENSMUSG00000025538
AA Change: L21P

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:FGE-sulfatase	25	136	6.2e-21	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000171300
AA Change: L30P

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000126036
Gene: ENSMUSG00000025538
AA Change: L30P

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
Pfam:FGE-sulfatase	34	299	3.9e-88	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000201029

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000201414

Predicted Effect

unknown
Transcript: ENSMUST00000201874
AA Change: L25P

SMART Domains

Protein: ENSMUSP00000144230
Gene: ENSMUSG00000025538
AA Change: L25P

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Pfam:FGE-sulfatase	29	135	3.5e-22	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000201927

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202466

Coding Region Coverage

1x: 99.4%
3x: 98.7%
10x: 97.2%
20x: 94.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The catalytic sites of sulfatases are only active if they contain a unique amino acid, C-alpha-formylglycine (FGly). The FGly residue is posttranslationally generated from a cysteine by enzymes with FGly-generating activity. The gene described in this record is a member of the sulfatase-modifying factor family and encodes a protein with a DUF323 domain that localizes to the lumen of the endoplasmic reticulum. This protein has low levels of FGly-generating activity but can heterodimerize with another family member - a protein with high levels of FGly-generating activity. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 22 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrf3	T	C	5: 30,402,358 (GRCm39)	I557V	probably damaging	Het
Bag6	T	A	17: 35,364,661 (GRCm39)	L983*	probably null	Het
Clcn1	A	G	6: 42,275,784 (GRCm39)	Y302C	probably damaging	Het
Dlc1	A	T	8: 37,041,306 (GRCm39)	C1308S	probably damaging	Het
Ebna1bp2	A	G	4: 118,478,133 (GRCm39)	D2G	probably damaging	Het
Exoc6b	T	A	6: 84,828,929 (GRCm39)	K485I	probably damaging	Het
Galnt3	C	T	2: 65,914,585 (GRCm39)	E611K	probably benign	Het
Gm5901	A	G	7: 105,026,507 (GRCm39)	I92V	probably benign	Het
Kcnh8	A	T	17: 53,263,763 (GRCm39)	L753F	probably benign	Het
L3mbtl4	T	C	17: 68,666,513 (GRCm39)	S14P	possibly damaging	Het
Map4k4	A	G	1: 40,025,925 (GRCm39)	H305R	probably damaging	Het
Nid1	A	T	13: 13,674,258 (GRCm39)	Y879F	probably benign	Het
Nsf	A	T	11: 103,749,869 (GRCm39)		probably null	Het
Olfml2a	G	A	2: 38,837,306 (GRCm39)	V150M	probably damaging	Het
Or51a24	A	G	7: 103,734,077 (GRCm39)	V70A	probably benign	Het
Pkhd1	A	T	1: 20,174,823 (GRCm39)	D3744E	possibly damaging	Het
Pla1a	A	T	16: 38,228,104 (GRCm39)	C258S	probably damaging	Het
Plk2	A	T	13: 110,534,243 (GRCm39)	R274S	probably benign	Het
Synpo2	T	C	3: 122,910,622 (GRCm39)	H341R	probably damaging	Het
Trbv12-1	G	A	6: 41,090,840 (GRCm39)	E71K	probably benign	Het
Usp17lc	T	C	7: 103,067,509 (GRCm39)	V268A	probably damaging	Het
Vmn1r36	A	T	6: 66,693,700 (GRCm39)	H21Q	probably benign	Het

Other mutations in Sumf2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00654:Sumf2	APN	5	129,882,918 (GRCm39)	intron	probably benign
IGL01285:Sumf2	APN	5	129,878,811 (GRCm39)	missense	probably damaging	1.00
IGL02247:Sumf2	APN	5	129,888,986 (GRCm39)	missense	probably damaging	0.98
IGL02348:Sumf2	APN	5	129,888,711 (GRCm39)	missense	probably damaging	1.00
IGL03074:Sumf2	APN	5	129,888,674 (GRCm39)	splice site	probably benign
R0105:Sumf2	UTSW	5	129,878,735 (GRCm39)	splice site	probably benign
R0105:Sumf2	UTSW	5	129,878,735 (GRCm39)	splice site	probably benign
R0751:Sumf2	UTSW	5	129,878,846 (GRCm39)	missense	probably benign	0.45
R1219:Sumf2	UTSW	5	129,883,613 (GRCm39)	missense	probably benign
R1565:Sumf2	UTSW	5	129,888,755 (GRCm39)	missense	probably damaging	1.00
R1678:Sumf2	UTSW	5	129,883,557 (GRCm39)	missense	possibly damaging	0.69
R1778:Sumf2	UTSW	5	129,873,909 (GRCm39)	unclassified	probably benign
R3930:Sumf2	UTSW	5	129,878,820 (GRCm39)	missense	probably benign	0.15
R6877:Sumf2	UTSW	5	129,878,867 (GRCm39)	missense	probably damaging	1.00
R7060:Sumf2	UTSW	5	129,883,341 (GRCm39)	missense	possibly damaging	0.66
R7326:Sumf2	UTSW	5	129,891,551 (GRCm39)	missense	probably benign	0.00
R7949:Sumf2	UTSW	5	129,881,759 (GRCm39)	missense	probably damaging	1.00
R8291:Sumf2	UTSW	5	129,887,138 (GRCm39)	critical splice donor site	probably null
R8356:Sumf2	UTSW	5	129,889,003 (GRCm39)	missense	possibly damaging	0.84
R8456:Sumf2	UTSW	5	129,889,003 (GRCm39)	missense	possibly damaging	0.84
R9185:Sumf2	UTSW	5	129,875,909 (GRCm39)	missense	possibly damaging	0.53
R9649:Sumf2	UTSW	5	129,891,482 (GRCm39)	missense	possibly damaging	0.86

Predicted Primers

PCR Primer
(F):5'- CCTGTGTTCATTCATGGGCG -3'
(R):5'- CTGAATACCAGAAGAGACCCTG -3'

Sequencing Primer
(F):5'- TCATTCATGGGCGGGCCTG -3'
(R):5'- GCAGTTTCATGATGGCCA -3'

Posted On

2015-01-11