Mutagenetix > Incidental Mutation

Incidental Mutation 'R2988:Trp53'

257841

Institutional Source

Beutler Lab

Gene Symbol

Trp53

Ensembl Gene

ENSMUSG00000059552

Gene Name

transformation related protein 53

Synonyms

p53, p44

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2988 (G1)

Quality Score

211

Status

Not validated

Chromosome

Chromosomal Location

69471185-69482699 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 69479332 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 170 (V170A)

Ref Sequence

ENSEMBL: ENSMUSP00000104298 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005371] [ENSMUST00000108657] [ENSMUST00000108658] [ENSMUST00000171247]

AlphaFold

P02340

Predicted Effect

probably damaging
Transcript: ENSMUST00000005371
AA Change: V167A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000005371
Gene: ENSMUSG00000059552
AA Change: V167A

Domain	Start	End	E-Value	Type
Pfam:P53_TAD	5	28	1.3e-10	PFAM
low complexity region	69	86	N/A	INTRINSIC
Pfam:P53	89	283	8.2e-108	PFAM
Pfam:P53_tetramer	312	353	4.4e-21	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000108657
AA Change: V167A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000104297
Gene: ENSMUSG00000059552
AA Change: V167A

Domain	Start	End	E-Value	Type
Pfam:P53_TAD	5	28	6.1e-11	PFAM
low complexity region	69	86	N/A	INTRINSIC
Pfam:P53	89	283	4.7e-108	PFAM
Pfam:P53_tetramer	312	353	1.9e-21	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000108658
AA Change: V170A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000104298
Gene: ENSMUSG00000059552
AA Change: V170A

Domain	Start	End	E-Value	Type
Pfam:P53_TAD	8	31	1.4e-12	PFAM
low complexity region	72	89	N/A	INTRINSIC
Pfam:P53	92	286	9.8e-113	PFAM
Pfam:P53_tetramer	316	355	5.8e-20	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130540

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147512

Predicted Effect

probably damaging
Transcript: ENSMUST00000171247
AA Change: V170A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000127130
Gene: ENSMUSG00000059552
AA Change: V170A

Domain	Start	End	E-Value	Type
Pfam:P53_TAD	8	31	1.2e-10	PFAM
low complexity region	72	89	N/A	INTRINSIC
Pfam:P53	92	286	7.9e-108	PFAM
Pfam:P53_tetramer	315	356	4.3e-21	PFAM

Coding Region Coverage

1x: 99.4%
3x: 98.6%
10x: 97.1%
20x: 94.4%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes tumor protein p53, which responds to diverse cellular stresses to regulate target genes that induce cell cycle arrest, apoptosis, senescence, DNA repair, or changes in metabolism. p53 protein is expressed at low level in normal cells and at a high level in a variety of transformed cell lines, where it's believed to contribute to transformation and malignancy. p53 is a DNA-binding protein containing transcription activation, DNA-binding, and oligomerization domains. It is postulated to bind to a p53-binding site and activate expression of downstream genes that inhibit growth and/or invasion, and thus function as a tumor suppressor. Mice deficient for this gene are developmentally normal but are susceptible to spontaneous tumors. Evidence to date shows that this gene contains one promoter, in contrast to alternative promoters of the human gene, and transcribes a few of splice variants which encode different isoforms, although the biological validity or the full-length nature of some variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this locus affect cell-cycle regulation and apoptosis. Null homozygotes show high, early-onset tumor incidence; some have persistent hyaloid vasculature and cataracts. Truncated or temperature-sensitive alleles cause early aging phenotypes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 15 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actn1	C	A	12: 80,239,162 (GRCm39)	A248S	possibly damaging	Het
Chd9	A	G	8: 91,757,088 (GRCm39)		probably null	Het
Cnot1	T	C	8: 96,470,906 (GRCm39)	E1314G	possibly damaging	Het
Exoc6b	T	A	6: 84,828,929 (GRCm39)	K485I	probably damaging	Het
Foxn1	C	G	11: 78,249,603 (GRCm39)	G641R	possibly damaging	Het
Kcnh7	T	A	2: 62,552,172 (GRCm39)	I940F	probably benign	Het
Lipk	T	C	19: 33,999,137 (GRCm39)	F139S	probably damaging	Het
Nr1h3	T	C	2: 91,015,349 (GRCm39)	N285S	probably damaging	Het
Or1r1	C	A	11: 73,874,627 (GRCm39)	R269L	probably benign	Het
Or5p60	G	A	7: 107,724,045 (GRCm39)	Q142*	probably null	Het
Ptpro	C	T	6: 137,420,597 (GRCm39)	Q188*	probably null	Het
Skic3	T	A	13: 76,303,808 (GRCm39)	M1242K	probably benign	Het
Slc22a8	A	G	19: 8,587,612 (GRCm39)	T529A	probably benign	Het
Spef2	A	T	15: 9,682,709 (GRCm39)	S591T	probably benign	Het
Tmem161b	C	T	13: 84,440,574 (GRCm39)	R149*	probably null	Het

Other mutations in Trp53

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01471:Trp53	APN	11	69,479,349 (GRCm39)	missense	probably damaging	1.00
IGL02105:Trp53	APN	11	69,479,329 (GRCm39)	missense	probably damaging	1.00
R0112:Trp53	UTSW	11	69,479,505 (GRCm39)	missense	probably damaging	1.00
R0196:Trp53	UTSW	11	69,479,506 (GRCm39)	missense	probably damaging	1.00
R0512:Trp53	UTSW	11	69,479,509 (GRCm39)	missense	probably damaging	1.00
R1976:Trp53	UTSW	11	69,479,323 (GRCm39)	missense	probably damaging	1.00
R2070:Trp53	UTSW	11	69,480,458 (GRCm39)	missense	probably damaging	1.00
R2071:Trp53	UTSW	11	69,480,458 (GRCm39)	missense	probably damaging	1.00
R4698:Trp53	UTSW	11	69,479,248 (GRCm39)	nonsense	probably null
R4776:Trp53	UTSW	11	69,477,747 (GRCm39)	missense	probably benign	0.05
R4838:Trp53	UTSW	11	69,478,456 (GRCm39)	missense	probably damaging	1.00
R5269:Trp53	UTSW	11	69,480,031 (GRCm39)	missense	probably damaging	1.00
R5360:Trp53	UTSW	11	69,479,566 (GRCm39)	critical splice donor site	probably null
R5399:Trp53	UTSW	11	69,479,372 (GRCm39)	missense	probably benign	0.19
R5420:Trp53	UTSW	11	69,479,146 (GRCm39)	intron	probably benign
R5982:Trp53	UTSW	11	69,478,244 (GRCm39)	missense	probably benign	0.06
R6051:Trp53	UTSW	11	69,480,434 (GRCm39)	missense	possibly damaging	0.93
R6305:Trp53	UTSW	11	69,479,533 (GRCm39)	missense	probably damaging	1.00
R6457:Trp53	UTSW	11	69,480,440 (GRCm39)	missense	probably damaging	1.00
R6947:Trp53	UTSW	11	69,479,307 (GRCm39)	missense	possibly damaging	0.93
R7278:Trp53	UTSW	11	69,482,081 (GRCm39)	missense	probably benign	0.00
R7339:Trp53	UTSW	11	69,480,015 (GRCm39)	missense	probably damaging	1.00
R7418:Trp53	UTSW	11	69,479,214 (GRCm39)	missense	probably damaging	1.00
R7899:Trp53	UTSW	11	69,481,519 (GRCm39)	missense	probably damaging	1.00
R8344:Trp53	UTSW	11	69,478,409 (GRCm39)	missense	probably damaging	1.00
R8796:Trp53	UTSW	11	69,480,434 (GRCm39)	missense	possibly damaging	0.93
R9197:Trp53	UTSW	11	69,480,000 (GRCm39)	missense	probably damaging	1.00
R9375:Trp53	UTSW	11	69,480,537 (GRCm39)	critical splice donor site	probably null
R9390:Trp53	UTSW	11	69,478,394 (GRCm39)	missense	probably benign	0.23
R9568:Trp53	UTSW	11	69,478,392 (GRCm39)	nonsense	probably null
Z1176:Trp53	UTSW	11	69,480,076 (GRCm39)	missense	probably null	0.94
Z1176:Trp53	UTSW	11	69,480,028 (GRCm39)	missense	probably damaging	1.00
Z1177:Trp53	UTSW	11	69,480,037 (GRCm39)	missense	probably damaging	0.99
Z1177:Trp53	UTSW	11	69,479,188 (GRCm39)	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- TTGACACCTGATCGTTACTCGG -3'
(R):5'- GCGAAAAGTCTGCCTGTCTTC -3'

Sequencing Primer
(F):5'- GATCGTTACTCGGCTTGTCC -3'
(R):5'- GAAAAGTCTGCCTGTCTTCCAGATAC -3'

Posted On

2015-01-11