Incidental Mutation 'R2988:Olfr398'
ID257842
Institutional Source Beutler Lab
Gene Symbol Olfr398
Ensembl Gene ENSMUSG00000049041
Gene Nameolfactory receptor 398
SynonymsGA_x6K02T2P1NL-4141430-4140486, MOR157-1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.206) question?
Stock #R2988 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location73979967-73990407 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 73983801 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 269 (R269L)
Ref Sequence ENSEMBL: ENSMUSP00000149170 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053874] [ENSMUST00000117510] [ENSMUST00000214334]
Predicted Effect probably benign
Transcript: ENSMUST00000053874
AA Change: R269L

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000059548
Gene: ENSMUSG00000049041
AA Change: R269L

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 4e-50 PFAM
Pfam:7TM_GPCR_Srsx 35 305 3.5e-5 PFAM
Pfam:7tm_1 41 290 1.3e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117510
AA Change: R269L

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000113005
Gene: ENSMUSG00000049041
AA Change: R269L

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 35 305 3.5e-5 PFAM
Pfam:7tm_1 41 290 6.4e-28 PFAM
Pfam:7tm_4 140 283 4.7e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214334
AA Change: R269L

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 15 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn1 C A 12: 80,192,388 A248S possibly damaging Het
Chd9 A G 8: 91,030,460 probably null Het
Cnot1 T C 8: 95,744,278 E1314G possibly damaging Het
Exoc6b T A 6: 84,851,947 K485I probably damaging Het
Foxn1 C G 11: 78,358,777 G641R possibly damaging Het
Kcnh7 T A 2: 62,721,828 I940F probably benign Het
Lipk T C 19: 34,021,737 F139S probably damaging Het
Nr1h3 T C 2: 91,185,004 N285S probably damaging Het
Olfr484 G A 7: 108,124,838 Q142* probably null Het
Ptpro C T 6: 137,443,599 Q188* probably null Het
Slc22a8 A G 19: 8,610,248 T529A probably benign Het
Spef2 A T 15: 9,682,623 S591T probably benign Het
Tmem161b C T 13: 84,292,455 R149* probably null Het
Trp53 T C 11: 69,588,506 V170A probably damaging Het
Ttc37 T A 13: 76,155,689 M1242K probably benign Het
Other mutations in Olfr398
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01084:Olfr398 APN 11 73984527 missense probably damaging 1.00
IGL01116:Olfr398 APN 11 73984318 missense probably damaging 1.00
R0242:Olfr398 UTSW 11 73983712 missense probably benign
R0242:Olfr398 UTSW 11 73983712 missense probably benign
R0647:Olfr398 UTSW 11 73983771 missense probably damaging 0.99
R0906:Olfr398 UTSW 11 73983859 missense probably damaging 0.99
R1581:Olfr398 UTSW 11 73984521 missense probably damaging 1.00
R1792:Olfr398 UTSW 11 73983847 missense probably benign 0.34
R1832:Olfr398 UTSW 11 73984493 missense probably damaging 0.98
R1879:Olfr398 UTSW 11 73984542 missense probably benign 0.00
R2138:Olfr398 UTSW 11 73984303 missense probably damaging 1.00
R4557:Olfr398 UTSW 11 73984599 missense probably benign 0.25
R4606:Olfr398 UTSW 11 73983892 missense probably damaging 1.00
R4777:Olfr398 UTSW 11 73984395 missense probably benign 0.01
R4783:Olfr398 UTSW 11 73984008 missense probably damaging 0.97
R5047:Olfr398 UTSW 11 73984378 missense probably damaging 1.00
R5696:Olfr398 UTSW 11 73984536 missense possibly damaging 0.90
R6379:Olfr398 UTSW 11 73984273 missense probably damaging 1.00
X0012:Olfr398 UTSW 11 73984294 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGTACTCTTCTTGACATGCCAG -3'
(R):5'- AGAGACTGCCATCTTCTCAGAG -3'

Sequencing Primer
(F):5'- TCTTGACATGCCAGTTAACCCAG -3'
(R):5'- CATCTTCTCAGAGGGGCTAACAGTG -3'
Posted On2015-01-11