Incidental Mutation 'R2989:C1galt1'
ID257860
Institutional Source Beutler Lab
Gene Symbol C1galt1
Ensembl Gene ENSMUSG00000042460
Gene Namecore 1 synthase, glycoprotein-N-acetylgalactosamine 3-beta-galactosyltransferase, 1
SynonymsT-synthase, core 1 beta3-Gal-T, 2210410E06Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2989 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location7844842-7875687 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 7866622 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 156 (D156G)
Ref Sequence ENSEMBL: ENSMUSP00000047931 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040159]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040159
AA Change: D156G

PolyPhen 2 Score 0.503 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000047931
Gene: ENSMUSG00000042460
AA Change: D156G

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Fringe 83 283 3e-18 PFAM
Pfam:Galactosyl_T 108 258 6.2e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203898
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene generates the common core 1 O-glycan structure, Gal-beta-1-3GalNAc-R, by the transfer of Gal from UDP-Gal to GalNAc-alpha-1-R. Core 1 is a precursor for many extended mucin-type O-glycans on cell surface and secreted glycoproteins. Studies in mice suggest that this gene plays a key role in thrombopoiesis and kidney homeostasis.[provided by RefSeq, Sep 2010]
PHENOTYPE: Embryos homozygous for a null allele show impaired angiogenesis, chaotic microvascular networks in brain, and fatal hemorrhage by E14. Eggs homozygous for another null allele show a slightly thinner zona pellucida. Mice homozygous for an ENU-induced allele develop thrombocytopenia and renal disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 G A 13: 81,581,747 T205I probably damaging Het
Arhgap32 T A 9: 32,239,398 N31K possibly damaging Het
Chrna3 C T 9: 55,016,050 C158Y probably damaging Het
Cnot1 T C 8: 95,744,278 E1314G possibly damaging Het
Coil C A 11: 88,987,979 A520D probably damaging Het
Cpe G T 8: 64,597,515 N386K probably benign Het
Fat4 T C 3: 39,007,153 I4295T probably benign Het
Foxn1 C G 11: 78,358,777 G641R possibly damaging Het
G530012D18Rik GAGAGAGACAGAGAGACAGAGA GAGAGAGACAGAGA 1: 85,577,216 probably null Het
Intu A G 3: 40,692,710 K671R probably benign Het
Jup T C 11: 100,376,841 D552G possibly damaging Het
Kcnk9 T C 15: 72,512,358 T324A unknown Het
Mettl5 G T 2: 69,881,315 A69E probably damaging Het
Olfr918 A T 9: 38,672,535 M303K probably benign Het
Rpf2 A G 10: 40,239,753 S77P probably benign Het
Sgo1 A G 17: 53,687,134 Y97H probably benign Het
Srsf12 T C 4: 33,223,599 Y33H probably damaging Het
Tcerg1 T A 18: 42,519,475 M56K unknown Het
Trafd1 T C 5: 121,379,466 T63A probably damaging Het
Ttc28 G A 5: 111,224,015 V777I probably benign Het
Ubr4 A G 4: 139,463,558 E937G possibly damaging Het
Zfp677 T C 17: 21,396,852 I57T probably benign Het
Zfp981 T A 4: 146,537,890 I424N probably benign Het
Other mutations in C1galt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00696:C1galt1 APN 6 7866475 missense probably damaging 0.98
PIT4378001:C1galt1 UTSW 6 7863944 missense probably benign 0.01
R0086:C1galt1 UTSW 6 7867051 splice site probably benign
R0540:C1galt1 UTSW 6 7871193 missense probably benign 0.00
R0567:C1galt1 UTSW 6 7866874 missense probably damaging 1.00
R0607:C1galt1 UTSW 6 7871193 missense probably benign 0.00
R1519:C1galt1 UTSW 6 7866402 missense probably damaging 0.99
R1712:C1galt1 UTSW 6 7871217 missense probably benign
R3035:C1galt1 UTSW 6 7866762 missense probably benign 0.06
R4271:C1galt1 UTSW 6 7866607 missense probably damaging 1.00
R4749:C1galt1 UTSW 6 7866379 missense probably benign 0.42
R5029:C1galt1 UTSW 6 7863931 missense possibly damaging 0.95
R5393:C1galt1 UTSW 6 7864143 critical splice donor site probably null
R5448:C1galt1 UTSW 6 7866658 missense possibly damaging 0.95
R7055:C1galt1 UTSW 6 7866585 missense probably damaging 1.00
R7319:C1galt1 UTSW 6 7871150 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTGAGAACCTCTATCAGAAAG -3'
(R):5'- CTTGCTTAGGACATAGCCCG -3'

Sequencing Primer
(F):5'- GGGTTATGACAAGTCCTCAAAATC -3'
(R):5'- TAGGACATAGCCCGCTCCTC -3'
Posted On2015-01-11