Incidental Mutation 'R2989:Rpf2'
ID257868
Institutional Source Beutler Lab
Gene Symbol Rpf2
Ensembl Gene ENSMUSG00000038510
Gene Nameribosome production factor 2 homolog
Synonyms2810470K21Rik, Bxdc1
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.953) question?
Stock #R2989 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location40223246-40247036 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 40239753 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 77 (S77P)
Ref Sequence ENSEMBL: ENSMUSP00000138581 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045114] [ENSMUST00000181995] [ENSMUST00000183052] [ENSMUST00000183114] [ENSMUST00000183309]
Predicted Effect probably benign
Transcript: ENSMUST00000045114
AA Change: S44P

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000035456
Gene: ENSMUSG00000038510
AA Change: S44P

DomainStartEndE-ValueType
Brix 1 195 3.25e-51 SMART
low complexity region 208 219 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000181995
SMART Domains Protein: ENSMUSP00000138425
Gene: ENSMUSG00000038510

DomainStartEndE-ValueType
Brix 34 202 8.11e-29 SMART
low complexity region 215 226 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183052
AA Change: S77P

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000138646
Gene: ENSMUSG00000038510
AA Change: S77P

DomainStartEndE-ValueType
Brix 34 175 6.08e-10 SMART
low complexity region 188 199 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183114
SMART Domains Protein: ENSMUSP00000138750
Gene: ENSMUSG00000038510

DomainStartEndE-ValueType
Brix 3 149 1.26e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183309
AA Change: S77P

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000138581
Gene: ENSMUSG00000038510
AA Change: S77P

DomainStartEndE-ValueType
Brix 34 228 3.25e-51 SMART
low complexity region 241 252 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 G A 13: 81,581,747 T205I probably damaging Het
Arhgap32 T A 9: 32,239,398 N31K possibly damaging Het
C1galt1 A G 6: 7,866,622 D156G possibly damaging Het
Chrna3 C T 9: 55,016,050 C158Y probably damaging Het
Cnot1 T C 8: 95,744,278 E1314G possibly damaging Het
Coil C A 11: 88,987,979 A520D probably damaging Het
Cpe G T 8: 64,597,515 N386K probably benign Het
Fat4 T C 3: 39,007,153 I4295T probably benign Het
Foxn1 C G 11: 78,358,777 G641R possibly damaging Het
G530012D18Rik GAGAGAGACAGAGAGACAGAGA GAGAGAGACAGAGA 1: 85,577,216 probably null Het
Intu A G 3: 40,692,710 K671R probably benign Het
Jup T C 11: 100,376,841 D552G possibly damaging Het
Kcnk9 T C 15: 72,512,358 T324A unknown Het
Mettl5 G T 2: 69,881,315 A69E probably damaging Het
Olfr918 A T 9: 38,672,535 M303K probably benign Het
Sgo1 A G 17: 53,687,134 Y97H probably benign Het
Srsf12 T C 4: 33,223,599 Y33H probably damaging Het
Tcerg1 T A 18: 42,519,475 M56K unknown Het
Trafd1 T C 5: 121,379,466 T63A probably damaging Het
Ttc28 G A 5: 111,224,015 V777I probably benign Het
Ubr4 A G 4: 139,463,558 E937G possibly damaging Het
Zfp677 T C 17: 21,396,852 I57T probably benign Het
Zfp981 T A 4: 146,537,890 I424N probably benign Het
Other mutations in Rpf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00800:Rpf2 APN 10 40239759 nonsense probably null
R0190:Rpf2 UTSW 10 40227601 missense probably damaging 1.00
R1880:Rpf2 UTSW 10 40233158 missense possibly damaging 0.52
R1912:Rpf2 UTSW 10 40236201 missense probably benign 0.22
R4401:Rpf2 UTSW 10 40236128 missense possibly damaging 0.91
R4843:Rpf2 UTSW 10 40247002 unclassified probably benign
R5092:Rpf2 UTSW 10 40246975 start codon destroyed probably null 0.63
R5394:Rpf2 UTSW 10 40233185 missense possibly damaging 0.48
R5473:Rpf2 UTSW 10 40227631 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- TCAAATCCTCACACTGTACAGGA -3'
(R):5'- CCTCTATTTTCCTCGGTGGGA -3'

Sequencing Primer
(F):5'- CATTACAGATGGTTGTGAGCCACC -3'
(R):5'- TCGGTGGGATTAAAGGTGTACCAC -3'
Posted On2015-01-11