Incidental Mutation 'R2989:Jup'
ID257872
Institutional Source Beutler Lab
Gene Symbol Jup
Ensembl Gene ENSMUSG00000001552
Gene Namejunction plakoglobin
SynonymsPG, gamma-catenin, Ctnng, plakoglobin, D930025P04Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2989 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location100368958-100397763 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 100376841 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 552 (D552G)
Ref Sequence ENSEMBL: ENSMUSP00000103026 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001592] [ENSMUST00000107403]
Predicted Effect possibly damaging
Transcript: ENSMUST00000001592
AA Change: D552G

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000001592
Gene: ENSMUSG00000001552
AA Change: D552G

DomainStartEndE-ValueType
low complexity region 52 63 N/A INTRINSIC
ARM 132 171 3.58e1 SMART
ARM 172 214 4.03e1 SMART
ARM 215 255 1.07e-4 SMART
ARM 256 297 1.66e-1 SMART
ARM 299 340 1.86e1 SMART
ARM 341 381 9.23e-9 SMART
ARM 382 420 2.29e1 SMART
ARM 422 464 7.34e-3 SMART
ARM 469 510 8.3e-2 SMART
ARM 511 572 7.45e-4 SMART
ARM 573 613 5.35e-5 SMART
ARM 614 654 1.56e1 SMART
low complexity region 708 723 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107403
AA Change: D552G

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103026
Gene: ENSMUSG00000001552
AA Change: D552G

DomainStartEndE-ValueType
low complexity region 52 63 N/A INTRINSIC
ARM 132 171 3.58e1 SMART
ARM 172 214 4.03e1 SMART
ARM 215 255 1.07e-4 SMART
ARM 256 297 1.66e-1 SMART
ARM 299 340 1.86e1 SMART
ARM 341 381 9.23e-9 SMART
ARM 382 420 2.29e1 SMART
ARM 422 464 7.34e-3 SMART
ARM 469 510 8.3e-2 SMART
ARM 511 572 7.45e-4 SMART
ARM 573 613 5.35e-5 SMART
ARM 614 654 1.56e1 SMART
low complexity region 708 723 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124659
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149798
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151476
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152774
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a major cytoplasmic protein which is the only known constituent common to submembranous plaques of both desmosomes and intermediate junctions. This protein forms distinct complexes with cadherins and desmosomal cadherins and is a member of the catenin family since it contains a distinct repeating amino acid motif called the armadillo repeat. Mutation in this gene has been associated with Naxos disease. Alternative splicing occurs in this gene; however, not all transcripts have been fully described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants die with severe heart defects at embryonic day 10.5-16, depending on genetic background. Mutants that survive to birth exhibit skin blistering and subcorneal acantholysis associated with reduced number of desmosomes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 G A 13: 81,581,747 T205I probably damaging Het
Arhgap32 T A 9: 32,239,398 N31K possibly damaging Het
C1galt1 A G 6: 7,866,622 D156G possibly damaging Het
Chrna3 C T 9: 55,016,050 C158Y probably damaging Het
Cnot1 T C 8: 95,744,278 E1314G possibly damaging Het
Coil C A 11: 88,987,979 A520D probably damaging Het
Cpe G T 8: 64,597,515 N386K probably benign Het
Fat4 T C 3: 39,007,153 I4295T probably benign Het
Foxn1 C G 11: 78,358,777 G641R possibly damaging Het
G530012D18Rik GAGAGAGACAGAGAGACAGAGA GAGAGAGACAGAGA 1: 85,577,216 probably null Het
Intu A G 3: 40,692,710 K671R probably benign Het
Kcnk9 T C 15: 72,512,358 T324A unknown Het
Mettl5 G T 2: 69,881,315 A69E probably damaging Het
Olfr918 A T 9: 38,672,535 M303K probably benign Het
Rpf2 A G 10: 40,239,753 S77P probably benign Het
Sgo1 A G 17: 53,687,134 Y97H probably benign Het
Srsf12 T C 4: 33,223,599 Y33H probably damaging Het
Tcerg1 T A 18: 42,519,475 M56K unknown Het
Trafd1 T C 5: 121,379,466 T63A probably damaging Het
Ttc28 G A 5: 111,224,015 V777I probably benign Het
Ubr4 A G 4: 139,463,558 E937G possibly damaging Het
Zfp677 T C 17: 21,396,852 I57T probably benign Het
Zfp981 T A 4: 146,537,890 I424N probably benign Het
Other mutations in Jup
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01141:Jup APN 11 100386249 missense probably benign
IGL01797:Jup APN 11 100381672 splice site probably benign
IGL01926:Jup APN 11 100383586 missense probably benign 0.00
IGL02030:Jup APN 11 100376991 missense probably damaging 0.96
IGL02073:Jup APN 11 100383389 splice site probably benign
IGL02218:Jup APN 11 100381839 missense probably damaging 1.00
IGL02450:Jup APN 11 100378357 missense probably damaging 1.00
IGL02955:Jup APN 11 100376739 missense probably benign 0.31
IGL02976:Jup APN 11 100378366 missense probably benign 0.40
IGL03023:Jup APN 11 100380692 splice site probably benign
IGL02802:Jup UTSW 11 100378378 missense probably benign
PIT4403001:Jup UTSW 11 100378087 critical splice donor site probably null
R0426:Jup UTSW 11 100372401 missense probably benign 0.02
R0626:Jup UTSW 11 100376763 missense probably benign
R1330:Jup UTSW 11 100372676 missense probably benign 0.02
R1437:Jup UTSW 11 100383576 missense probably benign 0.06
R1448:Jup UTSW 11 100383200 missense probably damaging 1.00
R1473:Jup UTSW 11 100379601 missense possibly damaging 0.79
R1686:Jup UTSW 11 100372434 missense probably damaging 0.96
R1824:Jup UTSW 11 100374137 nonsense probably null
R1875:Jup UTSW 11 100372294 unclassified probably null
R2017:Jup UTSW 11 100386341 missense probably benign 0.01
R3881:Jup UTSW 11 100378381 missense probably benign
R3882:Jup UTSW 11 100378381 missense probably benign
R4176:Jup UTSW 11 100372461 missense probably benign 0.03
R4612:Jup UTSW 11 100381834 missense probably damaging 0.98
R4808:Jup UTSW 11 100378192 missense probably damaging 0.99
R4854:Jup UTSW 11 100383041 missense possibly damaging 0.73
R4995:Jup UTSW 11 100379541 nonsense probably null
R5133:Jup UTSW 11 100383115 missense probably benign 0.02
R5408:Jup UTSW 11 100376781 missense probably damaging 1.00
R5641:Jup UTSW 11 100376806 missense possibly damaging 0.62
R5991:Jup UTSW 11 100379569 missense possibly damaging 0.59
R6431:Jup UTSW 11 100374341 missense probably benign 0.01
R6805:Jup UTSW 11 100383458 missense probably benign 0.17
R7022:Jup UTSW 11 100379553 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACCTAGACTACTCCTGGC -3'
(R):5'- TGTTTAAGGACTACCCGCCC -3'

Sequencing Primer
(F):5'- GACTACTCCTGGCCCACACATTC -3'
(R):5'- GCCCCTCCACTCATCACTG -3'
Posted On2015-01-11