Incidental Mutation 'R2991:5430419D17Rik'
ID257903
Institutional Source Beutler Lab
Gene Symbol 5430419D17Rik
Ensembl Gene ENSMUSG00000006204
Gene NameRIKEN cDNA 5430419D17 gene
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2991 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location131174402-131306451 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 131246700 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 861 (D861V)
Ref Sequence ENSEMBL: ENSMUSP00000150784 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050586] [ENSMUST00000124096] [ENSMUST00000208921]
Predicted Effect probably damaging
Transcript: ENSMUST00000050586
AA Change: D745V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000061529
Gene: ENSMUSG00000006204
AA Change: D745V

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 85 105 N/A INTRINSIC
SR 144 244 3.3e-57 SMART
CUB 272 378 1.2e-16 SMART
SR 428 528 3.9e-56 SMART
low complexity region 533 548 N/A INTRINSIC
CUB 556 667 5.1e-38 SMART
SR 680 780 1.5e-57 SMART
Pfam:CUB 795 840 3.1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000208921
AA Change: D861V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik C T 11: 58,610,690 V156I possibly damaging Het
Adamts15 T A 9: 30,921,394 T282S probably benign Het
Asic2 C A 11: 81,968,037 V50L probably benign Het
Cdadc1 T C 14: 59,586,072 M324V possibly damaging Het
Col12a1 A T 9: 79,700,265 V427D probably damaging Het
Col3a1 C A 1: 45,335,779 probably benign Het
Esp24 A T 17: 39,040,003 E31D possibly damaging Het
Igkv14-100 T A 6: 68,519,351 L76* probably null Het
Itsn2 T C 12: 4,658,474 V843A probably benign Het
Llgl2 T C 11: 115,851,120 S663P probably benign Het
Lsg1 T C 16: 30,561,729 N630S probably damaging Het
Msh4 A G 3: 153,905,860 V42A probably benign Het
Nkx6-1 T C 5: 101,659,535 Y327C probably damaging Het
Olfr1505 G A 19: 13,919,311 C97Y probably damaging Het
Pde4a T C 9: 21,203,243 S369P probably damaging Het
Pkdrej T C 15: 85,819,936 I600V probably benign Het
Plekhg6 T C 6: 125,370,469 E479G probably damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rap1gap2 C A 11: 74,407,322 A491S possibly damaging Het
Rgmb A T 17: 15,821,090 D78E probably damaging Het
Samd12 C T 15: 53,860,196 E34K probably damaging Het
Slc22a21 T G 11: 53,959,369 E220A probably damaging Het
Smc6 A G 12: 11,289,981 E430G probably damaging Het
Snx15 C A 19: 6,121,485 L186F probably damaging Het
Tiam2 A G 17: 3,518,250 E1557G probably benign Het
Vwa8 A T 14: 78,995,149 T644S probably benign Het
Zcchc4 T A 5: 52,804,438 F247Y probably damaging Het
Zmynd11 A G 13: 9,695,822 V165A probably damaging Het
Other mutations in 5430419D17Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:5430419D17Rik APN 7 131238094 unclassified probably null
IGL00848:5430419D17Rik APN 7 131246724 missense probably damaging 1.00
IGL00966:5430419D17Rik APN 7 131243107 nonsense probably null
IGL01286:5430419D17Rik APN 7 131246703 missense probably damaging 1.00
IGL01303:5430419D17Rik APN 7 131194331 missense possibly damaging 0.53
IGL01585:5430419D17Rik APN 7 131244758 missense probably damaging 0.97
IGL01665:5430419D17Rik APN 7 131246657 nonsense probably null
IGL01953:5430419D17Rik APN 7 131224980 missense probably benign 0.04
IGL02427:5430419D17Rik APN 7 131244788 missense probably damaging 0.99
IGL02508:5430419D17Rik APN 7 131222830 missense probably damaging 1.00
IGL02678:5430419D17Rik APN 7 131228917 missense probably damaging 1.00
IGL03092:5430419D17Rik APN 7 131201798 critical splice donor site probably null
IGL03122:5430419D17Rik APN 7 131196514 missense possibly damaging 0.68
IGL03343:5430419D17Rik APN 7 131246691 missense probably damaging 1.00
R0011:5430419D17Rik UTSW 7 131229993 missense probably damaging 0.99
R0011:5430419D17Rik UTSW 7 131229993 missense probably damaging 0.99
R0234:5430419D17Rik UTSW 7 131194303 splice site probably null
R0234:5430419D17Rik UTSW 7 131194303 splice site probably null
R0268:5430419D17Rik UTSW 7 131238176 missense probably damaging 1.00
R0383:5430419D17Rik UTSW 7 131239539 missense probably benign 0.05
R0973:5430419D17Rik UTSW 7 131238182 missense probably damaging 1.00
R0973:5430419D17Rik UTSW 7 131238182 missense probably damaging 1.00
R0974:5430419D17Rik UTSW 7 131238182 missense probably damaging 1.00
R1572:5430419D17Rik UTSW 7 131244831 nonsense probably null
R1911:5430419D17Rik UTSW 7 131238089 missense probably damaging 1.00
R2032:5430419D17Rik UTSW 7 131243052 missense probably damaging 1.00
R2097:5430419D17Rik UTSW 7 131181964 nonsense probably null
R2221:5430419D17Rik UTSW 7 131247457 critical splice acceptor site probably null
R2223:5430419D17Rik UTSW 7 131247457 critical splice acceptor site probably null
R2254:5430419D17Rik UTSW 7 131222905 missense probably damaging 1.00
R2913:5430419D17Rik UTSW 7 131182024 missense possibly damaging 0.90
R3439:5430419D17Rik UTSW 7 131188779 critical splice donor site probably null
R4418:5430419D17Rik UTSW 7 131247465 missense possibly damaging 0.86
R4916:5430419D17Rik UTSW 7 131174477 synonymous probably null
R5488:5430419D17Rik UTSW 7 131246595 missense probably damaging 1.00
R5594:5430419D17Rik UTSW 7 131239523 missense probably benign 0.12
R5897:5430419D17Rik UTSW 7 131196551 splice site probably null
R5898:5430419D17Rik UTSW 7 131241967 splice site probably null
R5940:5430419D17Rik UTSW 7 131238263 missense probably damaging 1.00
R6170:5430419D17Rik UTSW 7 131174487 splice site probably null
R6187:5430419D17Rik UTSW 7 131270599 intron probably benign
R6321:5430419D17Rik UTSW 7 131257006 critical splice donor site probably null
R6409:5430419D17Rik UTSW 7 131262071 intron probably benign
R6432:5430419D17Rik UTSW 7 131244872 critical splice donor site probably null
R6481:5430419D17Rik UTSW 7 131256801 missense probably benign 0.05
R6750:5430419D17Rik UTSW 7 131288245 intron probably benign
R6783:5430419D17Rik UTSW 7 131226764 missense probably damaging 0.99
R6836:5430419D17Rik UTSW 7 131196504 missense possibly damaging 0.84
R6925:5430419D17Rik UTSW 7 131222707 missense possibly damaging 0.92
R6995:5430419D17Rik UTSW 7 131222671 missense probably damaging 1.00
R7199:5430419D17Rik UTSW 7 131235912 nonsense probably null
R7205:5430419D17Rik UTSW 7 131277623 critical splice donor site probably null
R7340:5430419D17Rik UTSW 7 131277615 missense unknown
R7354:5430419D17Rik UTSW 7 131256729 missense possibly damaging 0.84
R7354:5430419D17Rik UTSW 7 131272033 missense unknown
R7434:5430419D17Rik UTSW 7 131279483 missense unknown
R7485:5430419D17Rik UTSW 7 131228833 missense probably damaging 0.99
Z1088:5430419D17Rik UTSW 7 131246633 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGACCAGTGCTGCGGTTG -3'
(R):5'- ATTTTCAATGGAGTCACATCCCTG -3'

Sequencing Primer
(F):5'- AGGCAGCTCTGGACAGTG -3'
(R):5'- AATGGAGTCACATCCCTGCTCTG -3'
Posted On2015-01-11