Incidental Mutation 'R2991:Itsn2'
ID257913
Institutional Source Beutler Lab
Gene Symbol Itsn2
Ensembl Gene ENSMUSG00000020640
Gene Nameintersectin 2
SynonymsSh3d1B, Eh domain, SH3 domain regulator of endocytosis 2, Ese2, Sh3p18
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2991 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location4592638-4713962 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4658474 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 843 (V843A)
Ref Sequence ENSEMBL: ENSMUSP00000151896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062580] [ENSMUST00000219007] [ENSMUST00000220311]
Predicted Effect probably benign
Transcript: ENSMUST00000062580
AA Change: V816A

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000052758
Gene: ENSMUSG00000020640
AA Change: V816A

DomainStartEndE-ValueType
EH 15 109 8.44e-41 SMART
EFh 58 86 7.18e-3 SMART
low complexity region 156 169 N/A INTRINSIC
low complexity region 215 231 N/A INTRINSIC
EH 238 333 4.06e-43 SMART
EFh 282 310 6.16e-2 SMART
coiled coil region 366 462 N/A INTRINSIC
coiled coil region 516 556 N/A INTRINSIC
coiled coil region 580 715 N/A INTRINSIC
SH3 721 778 2.65e-21 SMART
low complexity region 791 811 N/A INTRINSIC
SH3 855 909 8.83e-18 SMART
SH3 945 999 9.1e-20 SMART
SH3 1017 1077 1.55e-13 SMART
SH3 1091 1146 7.22e-23 SMART
RhoGEF 1174 1355 1.93e-56 SMART
PH 1396 1507 1.16e-9 SMART
C2 1531 1628 3.96e-19 SMART
Predicted Effect unknown
Transcript: ENSMUST00000217672
AA Change: V374A
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217882
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218072
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218352
Predicted Effect probably benign
Transcript: ENSMUST00000219007
AA Change: V816A

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219832
Predicted Effect probably benign
Transcript: ENSMUST00000220311
AA Change: V843A

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein which contains SH3 domains. This protein is a member of a family of proteins involved in clathrin-mediated endocytosis. Intersectin 2 is thought to regulate the formation of clathrin-coated vesicles and also may function in the induction of T cell antigen receptor (TCR) endocytosis. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal brain morphology and function and behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik C T 11: 58,610,690 V156I possibly damaging Het
5430419D17Rik A T 7: 131,246,700 D861V probably damaging Het
Adamts15 T A 9: 30,921,394 T282S probably benign Het
Asic2 C A 11: 81,968,037 V50L probably benign Het
Cdadc1 T C 14: 59,586,072 M324V possibly damaging Het
Col12a1 A T 9: 79,700,265 V427D probably damaging Het
Col3a1 C A 1: 45,335,779 probably benign Het
Esp24 A T 17: 39,040,003 E31D possibly damaging Het
Igkv14-100 T A 6: 68,519,351 L76* probably null Het
Llgl2 T C 11: 115,851,120 S663P probably benign Het
Lsg1 T C 16: 30,561,729 N630S probably damaging Het
Msh4 A G 3: 153,905,860 V42A probably benign Het
Nkx6-1 T C 5: 101,659,535 Y327C probably damaging Het
Olfr1505 G A 19: 13,919,311 C97Y probably damaging Het
Pde4a T C 9: 21,203,243 S369P probably damaging Het
Pkdrej T C 15: 85,819,936 I600V probably benign Het
Plekhg6 T C 6: 125,370,469 E479G probably damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rap1gap2 C A 11: 74,407,322 A491S possibly damaging Het
Rgmb A T 17: 15,821,090 D78E probably damaging Het
Samd12 C T 15: 53,860,196 E34K probably damaging Het
Slc22a21 T G 11: 53,959,369 E220A probably damaging Het
Smc6 A G 12: 11,289,981 E430G probably damaging Het
Snx15 C A 19: 6,121,485 L186F probably damaging Het
Tiam2 A G 17: 3,518,250 E1557G probably benign Het
Vwa8 A T 14: 78,995,149 T644S probably benign Het
Zcchc4 T A 5: 52,804,438 F247Y probably damaging Het
Zmynd11 A G 13: 9,695,822 V165A probably damaging Het
Other mutations in Itsn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Itsn2 APN 12 4658027 missense possibly damaging 0.95
IGL00647:Itsn2 APN 12 4613311 splice site probably benign
IGL00933:Itsn2 APN 12 4707540 missense probably damaging 1.00
IGL01686:Itsn2 APN 12 4636693 splice site probably benign
IGL01873:Itsn2 APN 12 4632366 splice site probably benign
IGL02200:Itsn2 APN 12 4636632 missense probably damaging 0.98
IGL02280:Itsn2 APN 12 4708961 missense possibly damaging 0.89
IGL02388:Itsn2 APN 12 4629557 missense possibly damaging 0.91
IGL02938:Itsn2 APN 12 4697216 missense probably damaging 0.98
inversus UTSW 12 4639670 nonsense probably null
liberator UTSW 12 4666176 nonsense probably null
rolled UTSW 12 4634792 nonsense probably null
stratofortress UTSW 12 4624927 missense probably damaging 1.00
R0101:Itsn2 UTSW 12 4633058 unclassified probably benign
R0268:Itsn2 UTSW 12 4700333 missense probably benign 0.12
R0584:Itsn2 UTSW 12 4697180 missense probably benign
R0604:Itsn2 UTSW 12 4658189 missense probably benign 0.01
R0639:Itsn2 UTSW 12 4712556 missense probably damaging 0.99
R0738:Itsn2 UTSW 12 4635681 missense probably benign 0.17
R1132:Itsn2 UTSW 12 4658464 missense probably damaging 1.00
R1163:Itsn2 UTSW 12 4712009 missense probably benign 0.30
R1169:Itsn2 UTSW 12 4639694 missense probably damaging 1.00
R1258:Itsn2 UTSW 12 4673464 missense probably damaging 1.00
R1297:Itsn2 UTSW 12 4700378 missense probably damaging 1.00
R1423:Itsn2 UTSW 12 4673572 missense probably damaging 0.97
R1572:Itsn2 UTSW 12 4650044 missense probably benign 0.03
R1601:Itsn2 UTSW 12 4658452 missense probably benign 0.01
R1628:Itsn2 UTSW 12 4629652 missense probably benign
R1650:Itsn2 UTSW 12 4637767 missense probably damaging 0.97
R1752:Itsn2 UTSW 12 4711950 splice site probably null
R1758:Itsn2 UTSW 12 4658160 missense possibly damaging 0.83
R1942:Itsn2 UTSW 12 4639670 nonsense probably null
R1976:Itsn2 UTSW 12 4672733 splice site probably benign
R2000:Itsn2 UTSW 12 4666176 nonsense probably null
R2060:Itsn2 UTSW 12 4627879 missense probably damaging 1.00
R2119:Itsn2 UTSW 12 4707025 missense probably benign 0.32
R2168:Itsn2 UTSW 12 4633044 unclassified probably benign
R2394:Itsn2 UTSW 12 4707005 missense possibly damaging 0.86
R2860:Itsn2 UTSW 12 4700315 splice site probably benign
R2861:Itsn2 UTSW 12 4700315 splice site probably benign
R2900:Itsn2 UTSW 12 4630713 unclassified probably benign
R3087:Itsn2 UTSW 12 4666303 missense probably damaging 1.00
R3881:Itsn2 UTSW 12 4634546 unclassified probably benign
R4022:Itsn2 UTSW 12 4624927 missense probably damaging 1.00
R4332:Itsn2 UTSW 12 4712611 missense possibly damaging 0.72
R4657:Itsn2 UTSW 12 4713197 makesense probably null
R4727:Itsn2 UTSW 12 4707660 missense probably damaging 0.99
R4745:Itsn2 UTSW 12 4661944 missense probably damaging 1.00
R4770:Itsn2 UTSW 12 4627892 missense probably damaging 1.00
R4905:Itsn2 UTSW 12 4634583 unclassified probably benign
R5269:Itsn2 UTSW 12 4633553 unclassified probably benign
R5314:Itsn2 UTSW 12 4627960 missense probably benign 0.09
R5345:Itsn2 UTSW 12 4672783 missense probably damaging 1.00
R5399:Itsn2 UTSW 12 4653535 missense probably benign 0.22
R5566:Itsn2 UTSW 12 4626554 missense probably damaging 1.00
R5725:Itsn2 UTSW 12 4630767 unclassified probably benign
R5773:Itsn2 UTSW 12 4707089 missense probably damaging 1.00
R6116:Itsn2 UTSW 12 4629939 unclassified probably benign
R6254:Itsn2 UTSW 12 4624982 splice site probably null
R6325:Itsn2 UTSW 12 4706351 missense probably damaging 1.00
R6361:Itsn2 UTSW 12 4629655 missense probably benign 0.18
R6456:Itsn2 UTSW 12 4629923 unclassified probably benign
R6494:Itsn2 UTSW 12 4634792 nonsense probably null
R6854:Itsn2 UTSW 12 4652382 missense probably benign 0.37
R6941:Itsn2 UTSW 12 4629641 missense probably benign 0.05
R6961:Itsn2 UTSW 12 4673420 nonsense probably null
R7326:Itsn2 UTSW 12 4632985 missense unknown
R7387:Itsn2 UTSW 12 4639781 missense probably damaging 1.00
R7465:Itsn2 UTSW 12 4706983 nonsense probably null
R7471:Itsn2 UTSW 12 4708198 missense probably benign 0.43
Z1088:Itsn2 UTSW 12 4712472 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGGCACTTCCAACATTTC -3'
(R):5'- AGAAATCAGGTTTCAGTTGCAC -3'

Sequencing Primer
(F):5'- GCTGGCACTTCCAACATTTCAATAC -3'
(R):5'- ATCAGGTTTCAGTTGCACATCAC -3'
Posted On2015-01-11