Mutagenetix > Incidental Mutation

Incidental Mutation 'R2992:Kdm6b'

257943

Institutional Source

Beutler Lab

Gene Symbol

Kdm6b

Ensembl Gene

ENSMUSG00000018476

Gene Name

KDM1 lysine (K)-specific demethylase 6B

Synonyms

Jmjd3

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2992 (G1)

Quality Score

119

Status

Not validated

Chromosome

Chromosomal Location

69289334-69304501 bp(-) (GRCm39)

Type of Mutation

small deletion (1 aa in frame mutation)

DNA Base Change (assembly)

ACTGCTGCTGCTGCTGCTGCTGCTG to ACTGCTGCTGCTGCTGCTGCTG at 69297133 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000091620 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094077]

AlphaFold

Q5NCY0

PDB Structure

The free structure of the mouse C-terminal domain of KDM6B [X-RAY DIFFRACTION]
free KDM6B structure [X-RAY DIFFRACTION]
the crystal structure of KDM6B bound with H3K27me3 peptide [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000094077

SMART Domains

Protein: ENSMUSP00000091620
Gene: ENSMUSG00000018476

Domain	Start	End	E-Value	Type
low complexity region	29	43	N/A	INTRINSIC
low complexity region	54	71	N/A	INTRINSIC
SCOP:d1elwa_	91	152	9e-5	SMART
low complexity region	214	227	N/A	INTRINSIC
low complexity region	239	270	N/A	INTRINSIC
low complexity region	312	329	N/A	INTRINSIC
low complexity region	333	345	N/A	INTRINSIC
low complexity region	389	415	N/A	INTRINSIC
low complexity region	461	487	N/A	INTRINSIC
low complexity region	515	524	N/A	INTRINSIC
low complexity region	544	577	N/A	INTRINSIC
low complexity region	585	615	N/A	INTRINSIC
low complexity region	643	650	N/A	INTRINSIC
low complexity region	711	719	N/A	INTRINSIC
low complexity region	743	766	N/A	INTRINSIC
low complexity region	771	811	N/A	INTRINSIC
low complexity region	840	879	N/A	INTRINSIC
low complexity region	890	909	N/A	INTRINSIC
low complexity region	950	989	N/A	INTRINSIC
low complexity region	993	1011	N/A	INTRINSIC
low complexity region	1044	1068	N/A	INTRINSIC
low complexity region	1284	1317	N/A	INTRINSIC
JmjC	1337	1500	1.61e-47	SMART
Blast:JmjC	1536	1600	1e-18	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129924

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156562

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a lysine-specific demethylase that specifically demethylates di- or tri-methylated lysine 27 of histone H3 (H3K27me2 or H3K27me3). H3K27 trimethylation is a repressive epigenetic mark controlling chromatin organization and gene silencing. This protein can also demethylate non-histone proteins such as retinoblastoma protein. Through its demethylation actvity this gene influences cellular differentiation and development, tumorigenesis, inflammatory diseases, and neurodegenerative diseases. This protein has two classical nuclear localization signals at its N-terminus. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a null allele show perinatal death, thick alveolar septum, and absence of air space in the lungs. Mice homozygous for a different null allele die neonatally displaying abnormal lung development, dwarfism, kyphosis, short limbs, and a severe delay in endochondral ossification. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 17 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Atp4a	G	A	7: 30,419,650 (GRCm39)	R671Q	probably benign	Het
Baat	A	T	4: 49,499,675 (GRCm39)	Y210*	probably null	Het
Cdh15	G	A	8: 123,588,763 (GRCm39)	R279Q	probably damaging	Het
Cep295	T	A	9: 15,244,043 (GRCm39)	K1471I	probably damaging	Het
Cpne4	A	T	9: 104,899,564 (GRCm39)	I416F	probably damaging	Het
Cul7	C	G	17: 46,962,526 (GRCm39)	D52E	probably benign	Het
Isg20	C	T	7: 78,569,632 (GRCm39)	A201V	probably benign	Het
Mmp16	G	T	4: 18,011,657 (GRCm39)	G191C	probably damaging	Het
Or51aa5	C	T	7: 103,166,977 (GRCm39)	V205M	probably damaging	Het
Or6c2b	C	A	10: 128,947,404 (GRCm39)	E297*	probably null	Het
Or9m2	T	C	2: 87,821,121 (GRCm39)	V222A	probably benign	Het
Patl2	T	C	2: 121,956,235 (GRCm39)	S210G	probably damaging	Het
Plekha6	T	C	1: 133,222,396 (GRCm39)	I994T	probably damaging	Het
Rap1gap2	C	A	11: 74,298,148 (GRCm39)	A491S	possibly damaging	Het
Rhobtb2	A	G	14: 70,035,772 (GRCm39)	S100P	probably damaging	Het
Snx13	T	C	12: 35,155,190 (GRCm39)	L418P	probably damaging	Het
Spink5	A	C	18: 44,129,696 (GRCm39)	E429A	probably damaging	Het

Other mutations in Kdm6b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00484:Kdm6b	APN	11	69,297,132 (GRCm39)	missense	possibly damaging	0.85
IGL02271:Kdm6b	APN	11	69,296,893 (GRCm39)	missense	possibly damaging	0.65
beine	UTSW	11	69,294,418 (GRCm39)	missense	unknown
Gaudy	UTSW	11	69,291,032 (GRCm39)	missense	unknown
Hypocrisy	UTSW	11	69,292,977 (GRCm39)	nonsense	probably null
Knochen	UTSW	11	69,290,881 (GRCm39)	unclassified	probably benign
Ostentatious	UTSW	11	69,294,424 (GRCm39)	missense	unknown
Piquant	UTSW	11	69,294,620 (GRCm39)	missense	unknown
preen	UTSW	11	69,292,919 (GRCm39)	missense	unknown
Tart	UTSW	11	69,297,192 (GRCm39)	missense	probably damaging	1.00
BB007:Kdm6b	UTSW	11	69,290,778 (GRCm39)	missense	unknown
BB017:Kdm6b	UTSW	11	69,290,778 (GRCm39)	missense	unknown
PIT4458001:Kdm6b	UTSW	11	69,290,778 (GRCm39)	missense	unknown
R0455:Kdm6b	UTSW	11	69,297,822 (GRCm39)	nonsense	probably null
R0645:Kdm6b	UTSW	11	69,295,844 (GRCm39)	missense	unknown
R1659:Kdm6b	UTSW	11	69,298,414 (GRCm39)	missense	possibly damaging	0.88
R1855:Kdm6b	UTSW	11	69,298,112 (GRCm39)	missense	probably damaging	0.99
R1962:Kdm6b	UTSW	11	69,292,191 (GRCm39)	unclassified	probably benign
R1993:Kdm6b	UTSW	11	69,297,129 (GRCm39)	missense	probably null	0.85
R2029:Kdm6b	UTSW	11	69,294,418 (GRCm39)	missense	unknown
R2181:Kdm6b	UTSW	11	69,291,952 (GRCm39)	nonsense	probably null
R2215:Kdm6b	UTSW	11	69,295,870 (GRCm39)	missense	unknown
R2904:Kdm6b	UTSW	11	69,296,611 (GRCm39)	missense	possibly damaging	0.63
R3236:Kdm6b	UTSW	11	69,297,192 (GRCm39)	missense	probably damaging	1.00
R3950:Kdm6b	UTSW	11	69,296,441 (GRCm39)	missense	probably damaging	1.00
R4027:Kdm6b	UTSW	11	69,297,094 (GRCm39)	missense	possibly damaging	0.92
R4830:Kdm6b	UTSW	11	69,294,620 (GRCm39)	missense	unknown
R4996:Kdm6b	UTSW	11	69,296,557 (GRCm39)	missense	probably damaging	1.00
R5034:Kdm6b	UTSW	11	69,292,736 (GRCm39)	splice site	probably benign
R5140:Kdm6b	UTSW	11	69,290,881 (GRCm39)	unclassified	probably benign
R5160:Kdm6b	UTSW	11	69,291,594 (GRCm39)	unclassified	probably benign
R5240:Kdm6b	UTSW	11	69,292,730 (GRCm39)	splice site	probably benign
R5273:Kdm6b	UTSW	11	69,295,027 (GRCm39)	missense	unknown
R5386:Kdm6b	UTSW	11	69,291,636 (GRCm39)	unclassified	probably benign
R5597:Kdm6b	UTSW	11	69,296,900 (GRCm39)	missense	probably damaging	0.96
R5598:Kdm6b	UTSW	11	69,296,900 (GRCm39)	missense	probably damaging	0.96
R5812:Kdm6b	UTSW	11	69,296,755 (GRCm39)	missense	probably damaging	0.98
R5976:Kdm6b	UTSW	11	69,294,614 (GRCm39)	critical splice donor site	probably null
R6000:Kdm6b	UTSW	11	69,294,424 (GRCm39)	missense	unknown
R6145:Kdm6b	UTSW	11	69,295,852 (GRCm39)	missense	unknown
R6191:Kdm6b	UTSW	11	69,297,584 (GRCm39)	missense	probably benign	0.01
R6256:Kdm6b	UTSW	11	69,297,555 (GRCm39)	missense	probably damaging	0.96
R6304:Kdm6b	UTSW	11	69,295,084 (GRCm39)	missense	unknown
R6917:Kdm6b	UTSW	11	69,297,419 (GRCm39)	missense	probably benign	0.04
R6939:Kdm6b	UTSW	11	69,297,588 (GRCm39)	missense	probably damaging	0.99
R7356:Kdm6b	UTSW	11	69,292,991 (GRCm39)	nonsense	probably null
R7644:Kdm6b	UTSW	11	69,291,032 (GRCm39)	missense	unknown
R7673:Kdm6b	UTSW	11	69,296,568 (GRCm39)	missense	probably damaging	0.98
R7698:Kdm6b	UTSW	11	69,296,807 (GRCm39)	missense	probably benign	0.14
R7776:Kdm6b	UTSW	11	69,296,960 (GRCm39)	missense	possibly damaging	0.84
R7930:Kdm6b	UTSW	11	69,290,778 (GRCm39)	missense	unknown
R8383:Kdm6b	UTSW	11	69,296,876 (GRCm39)	missense	probably benign
R8725:Kdm6b	UTSW	11	69,292,919 (GRCm39)	missense	unknown
R8727:Kdm6b	UTSW	11	69,292,919 (GRCm39)	missense	unknown
R8813:Kdm6b	UTSW	11	69,297,658 (GRCm39)	small insertion	probably benign
R8813:Kdm6b	UTSW	11	69,297,655 (GRCm39)	small insertion	probably benign
R8851:Kdm6b	UTSW	11	69,291,993 (GRCm39)	missense	unknown
R9074:Kdm6b	UTSW	11	69,292,977 (GRCm39)	nonsense	probably null
R9130:Kdm6b	UTSW	11	69,295,424 (GRCm39)	missense	unknown
R9179:Kdm6b	UTSW	11	69,297,521 (GRCm39)	critical splice donor site	probably null
R9535:Kdm6b	UTSW	11	69,297,276 (GRCm39)	nonsense	probably null
Z1177:Kdm6b	UTSW	11	69,294,692 (GRCm39)	missense	unknown

Predicted Primers

PCR Primer
(F):5'- TATCTCCAGCGCAGGGTTTTG -3'
(R):5'- ATGCCTCATTCATATCCATACCCAG -3'

Sequencing Primer
(F):5'- TGGTAATGGTCAGCGCCAG -3'
(R):5'- ACACCCCTTGGTCCAGGTC -3'

Posted On

2015-01-11