Incidental Mutation 'R0325:Galnt6'
ID25796
Institutional Source Beutler Lab
Gene Symbol Galnt6
Ensembl Gene ENSMUSG00000037280
Gene Namepolypeptide N-acetylgalactosaminyltransferase 6
SynonymsGalNAc-T6
MMRRC Submission 038535-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.265) question?
Stock #R0325 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location100691813-100729376 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 100693471 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000124793 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052069] [ENSMUST00000159715] [ENSMUST00000161514]
Predicted Effect probably null
Transcript: ENSMUST00000052069
SMART Domains Protein: ENSMUSP00000056705
Gene: ENSMUSG00000037280

DomainStartEndE-ValueType
low complexity region 1 16 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 177 431 4.2e-10 PFAM
Pfam:Glycos_transf_2 180 366 8.8e-36 PFAM
Pfam:Glyco_transf_7C 337 415 8.5e-14 PFAM
RICIN 496 622 1.53e-27 SMART
Predicted Effect probably null
Transcript: ENSMUST00000159715
SMART Domains Protein: ENSMUSP00000123848
Gene: ENSMUSG00000037280

DomainStartEndE-ValueType
low complexity region 1 16 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 177 432 1e-10 PFAM
Pfam:Glycos_transf_2 180 366 4.1e-31 PFAM
Pfam:Glyco_transf_7C 337 415 6.7e-13 PFAM
RICIN 496 622 1.53e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160960
Predicted Effect probably null
Transcript: ENSMUST00000161514
SMART Domains Protein: ENSMUSP00000124793
Gene: ENSMUSG00000037280

DomainStartEndE-ValueType
low complexity region 1 16 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 177 431 4.2e-10 PFAM
Pfam:Glycos_transf_2 180 366 8.8e-36 PFAM
Pfam:Glyco_transf_7C 337 415 8.5e-14 PFAM
RICIN 496 622 1.53e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229209
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229410
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.9%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase (GalNAc-T) family of enzymes. GalNAc-Ts initiate mucin-type O-linked glycosylation in the Golgi apparatus by catalyzing the transfer of GalNAc to serine and threonine residues on target proteins. They are characterized by an N-terminal transmembrane domain, a stem region, a lumenal catalytic domain containing a GT1 motif and Gal/GalNAc transferase motif, and a C-terminal ricin/lectin-like domain. GalNAc-Ts have different, but overlapping, substrate specificities and patterns of expression. The encoded protein is capable of glycosylating fibronectin peptide in vitro and is expressed in a fibroblast cell line, indicating that it may be involved in the synthesis of oncofetal fibronectin. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik G T 1: 26,685,266 Q278K possibly damaging Het
4933416C03Rik T C 10: 116,113,569 I17M probably damaging Het
5330417C22Rik A G 3: 108,461,251 L808P probably damaging Het
Adcyap1 A G 17: 93,202,832 D96G probably benign Het
Adgrv1 C T 13: 81,540,015 V1749M probably damaging Het
Adnp2 A T 18: 80,130,653 N180K probably benign Het
Ahdc1 G T 4: 133,062,719 A424S unknown Het
Alpk3 G A 7: 81,067,953 R86H possibly damaging Het
Atf7ip A C 6: 136,560,989 T49P possibly damaging Het
Atp7b G A 8: 22,028,451 L124F probably benign Het
Bub1 A T 2: 127,801,394 L1010* probably null Het
Cd300c C A 11: 114,959,585 E131* probably null Het
Cep135 A G 5: 76,615,743 K527E probably damaging Het
Cfd G T 10: 79,891,758 E89* probably null Het
Crb1 A C 1: 139,241,166 C871W probably damaging Het
D6Ertd527e A T 6: 87,111,295 S147C unknown Het
Ddx60 A T 8: 61,983,855 E946D probably benign Het
Dmrt1 G A 19: 25,546,007 E241K probably benign Het
Dnah11 C G 12: 118,012,339 V2782L probably benign Het
Dzip1 T C 14: 118,909,557 I313M probably damaging Het
Egln3 T C 12: 54,203,512 E17G probably benign Het
Eif3d A G 15: 77,968,220 V42A probably damaging Het
Eogt C A 6: 97,113,955 G408W probably damaging Het
Fip1l1 T A 5: 74,595,842 N498K probably damaging Het
Fmn2 T A 1: 174,609,954 probably null Het
Fndc3b T C 3: 27,467,430 E532G probably damaging Het
Gabrb3 T C 7: 57,765,530 L116P probably damaging Het
Glmp G A 3: 88,325,084 M1I probably null Het
Gm13101 A T 4: 143,966,740 V56E probably damaging Het
Gm13124 T C 4: 144,555,511 Y237C probably damaging Het
Gm5478 T C 15: 101,644,326 D79G probably damaging Het
Gnb1 T G 4: 155,551,683 D153E probably benign Het
Grik2 T C 10: 49,240,725 I86V probably damaging Het
Hdac3 C T 18: 37,940,952 probably null Het
Hdgfl2 G A 17: 56,099,181 R523H possibly damaging Het
Ifngr1 T A 10: 19,597,432 N43K probably damaging Het
Iqgap1 A G 7: 80,751,930 W476R probably benign Het
Jag1 A G 2: 137,095,445 probably null Het
Kars T C 8: 112,008,216 D46G probably benign Het
Kcnd2 A G 6: 21,216,683 I129V probably damaging Het
Lama3 A C 18: 12,482,126 D1369A probably damaging Het
Lars A T 18: 42,250,902 V76E possibly damaging Het
Lgals9 T C 11: 78,963,448 I337V probably damaging Het
Lrp1b T C 2: 40,851,711 D3068G probably damaging Het
Med12l A G 3: 59,077,059 T462A possibly damaging Het
Megf9 T A 4: 70,455,941 D286V probably damaging Het
Meox1 T A 11: 101,879,401 S167C probably damaging Het
Mier2 C T 10: 79,542,596 probably null Het
Mrps2 C A 2: 28,469,779 T216K probably damaging Het
Mto1 A T 9: 78,453,004 D258V probably damaging Het
Mug1 A T 6: 121,849,842 H208L probably benign Het
Myo15b T A 11: 115,884,265 I751N probably damaging Het
Napg C T 18: 62,986,963 R149C probably damaging Het
Ndrg4 T A 8: 95,710,935 M17K probably damaging Het
Nfrkb T G 9: 31,414,180 M973R probably benign Het
Nxph4 C T 10: 127,526,911 R37H probably damaging Het
Oas1e A G 5: 120,795,395 I35T probably damaging Het
Oc90 C T 15: 65,897,665 probably null Het
Olfr1045 G A 2: 86,198,711 L14F possibly damaging Het
Olfr1076 A T 2: 86,509,205 T249S probably benign Het
Olfr1271 A T 2: 90,265,536 M298K probably null Het
Olfr461 A T 6: 40,544,123 N285K possibly damaging Het
Olfr653 A T 7: 104,580,360 D238V probably damaging Het
Papola T A 12: 105,807,193 I157N probably damaging Het
Pcyox1l G C 18: 61,697,893 P303A possibly damaging Het
Pkdrej T C 15: 85,819,551 N728S probably benign Het
Pkp4 A G 2: 59,318,529 D542G probably damaging Het
Pla2g5 C T 4: 138,800,656 D100N probably benign Het
Poln C T 5: 34,149,764 R31H probably benign Het
Ppp3ca G A 3: 136,935,139 A484T probably benign Het
Prag1 A G 8: 36,103,804 T514A probably benign Het
Prex2 G A 1: 11,200,057 probably null Het
Prrc2b G T 2: 32,199,091 W403L probably damaging Het
Pter A T 2: 13,000,937 K307M probably damaging Het
Ptpn5 G A 7: 47,090,758 S99L probably benign Het
Ptpn5 A C 7: 47,090,759 S99A probably benign Het
Rpap1 A C 2: 119,771,840 H674Q probably benign Het
Rph3a A T 5: 120,943,064 D623E probably benign Het
Sdr9c7 G T 10: 127,898,719 E25D probably benign Het
Sept9 T G 11: 117,356,632 V479G probably damaging Het
Sgo2a A G 1: 58,016,697 D680G probably benign Het
Sgo2b A T 8: 63,928,376 I474N probably benign Het
Sgsm1 A T 5: 113,288,835 I43N probably damaging Het
Shprh G A 10: 11,170,109 M891I probably benign Het
Skiv2l A T 17: 34,844,815 Y551N possibly damaging Het
Slc12a9 A G 5: 137,322,846 M469T probably damaging Het
Slc4a2 A T 5: 24,435,943 I747F probably damaging Het
Slc7a6 T A 8: 106,194,517 N373K probably damaging Het
Slc7a6os T C 8: 106,201,056 D296G probably benign Het
Sncaip A G 18: 52,905,809 T120A probably damaging Het
Sorcs1 G C 19: 50,313,042 probably null Het
Spata16 A G 3: 26,667,456 E42G probably damaging Het
Syne2 A T 12: 75,962,641 M2440L probably benign Het
Tead2 A G 7: 45,225,755 E232G probably damaging Het
Tmf1 T G 6: 97,176,504 T203P possibly damaging Het
Trrap C A 5: 144,816,395 H1843Q probably benign Het
Unc79 C A 12: 103,171,644 Q2314K probably damaging Het
Unc80 G T 1: 66,510,881 G766V probably damaging Het
Vmn1r217 A G 13: 23,114,594 L46P probably damaging Het
Vmn2r80 A T 10: 79,148,939 I42F possibly damaging Het
Vwa5a T C 9: 38,728,665 V403A probably damaging Het
Zfp42 T C 8: 43,295,951 E171G probably damaging Het
Zfp64 A T 2: 168,926,040 S551T probably benign Het
Other mutations in Galnt6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02024:Galnt6 APN 15 100703493 missense probably benign 0.16
IGL02606:Galnt6 APN 15 100714219 missense probably damaging 1.00
R0336:Galnt6 UTSW 15 100699206 missense probably damaging 0.99
R0504:Galnt6 UTSW 15 100696657 splice site probably benign
R1563:Galnt6 UTSW 15 100703378 missense probably benign 0.00
R1903:Galnt6 UTSW 15 100716118 missense possibly damaging 0.79
R2007:Galnt6 UTSW 15 100697166 missense probably damaging 1.00
R2114:Galnt6 UTSW 15 100714241 missense probably damaging 1.00
R2943:Galnt6 UTSW 15 100714279 splice site probably null
R3410:Galnt6 UTSW 15 100699137 missense probably damaging 1.00
R3954:Galnt6 UTSW 15 100697168 missense possibly damaging 0.72
R4754:Galnt6 UTSW 15 100699224 missense probably damaging 1.00
R4910:Galnt6 UTSW 15 100716178 missense probably benign
R4911:Galnt6 UTSW 15 100716178 missense probably benign
R4962:Galnt6 UTSW 15 100696574 nonsense probably null
R5237:Galnt6 UTSW 15 100693393 missense probably damaging 1.00
R5293:Galnt6 UTSW 15 100703501 missense probably benign 0.00
R5605:Galnt6 UTSW 15 100697225 missense probably damaging 1.00
R5752:Galnt6 UTSW 15 100704126 missense probably damaging 1.00
R5837:Galnt6 UTSW 15 100694646 missense possibly damaging 0.70
R5949:Galnt6 UTSW 15 100696550 missense probably damaging 1.00
R6051:Galnt6 UTSW 15 100694668 missense probably damaging 1.00
R6306:Galnt6 UTSW 15 100693424 missense possibly damaging 0.70
R6522:Galnt6 UTSW 15 100693355 makesense probably null
R6959:Galnt6 UTSW 15 100714125 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTTGTTGCAAGAAGAACATCCTGCC -3'
(R):5'- GCTAAAGCTGCTGTGTGCATCTCG -3'

Sequencing Primer
(F):5'- GGCCACAGGGCTTCAAAATC -3'
(R):5'- CAGAATCAGAATCGGAATCGGAAC -3'
Posted On2013-04-16