Incidental Mutation 'R0326:Mfn2'
ID25801
Institutional Source Beutler Lab
Gene Symbol Mfn2
Ensembl Gene ENSMUSG00000029020
Gene Namemitofusin 2
Synonymshypertension related protein 1, D630023P19Rik, Fzo
MMRRC Submission 038536-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0326 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location147873599-147904704 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 147883288 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 441 (L441P)
Ref Sequence ENSEMBL: ENSMUSP00000101341 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030884] [ENSMUST00000105714] [ENSMUST00000105715] [ENSMUST00000105716] [ENSMUST00000134172]
Predicted Effect probably damaging
Transcript: ENSMUST00000030884
AA Change: L441P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030884
Gene: ENSMUSG00000029020
AA Change: L441P

DomainStartEndE-ValueType
Pfam:MMR_HSR1 98 258 3.8e-6 PFAM
Pfam:Dynamin_N 99 259 2e-24 PFAM
low complexity region 336 347 N/A INTRINSIC
coiled coil region 406 433 N/A INTRINSIC
Pfam:Fzo_mitofusin 594 754 1.6e-77 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105714
AA Change: L441P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101339
Gene: ENSMUSG00000029020
AA Change: L441P

DomainStartEndE-ValueType
Pfam:MMR_HSR1 98 258 6.1e-7 PFAM
Pfam:Dynamin_N 99 259 3.6e-25 PFAM
low complexity region 336 347 N/A INTRINSIC
coiled coil region 406 433 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105715
AA Change: L441P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101340
Gene: ENSMUSG00000029020
AA Change: L441P

DomainStartEndE-ValueType
Pfam:MMR_HSR1 98 258 9e-7 PFAM
Pfam:Dynamin_N 99 259 5.4e-25 PFAM
low complexity region 336 347 N/A INTRINSIC
coiled coil region 406 433 N/A INTRINSIC
Pfam:Fzo_mitofusin 586 756 3.9e-86 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105716
AA Change: L441P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101341
Gene: ENSMUSG00000029020
AA Change: L441P

DomainStartEndE-ValueType
Pfam:MMR_HSR1 98 258 9e-7 PFAM
Pfam:Dynamin_N 99 259 5.4e-25 PFAM
low complexity region 336 347 N/A INTRINSIC
coiled coil region 406 433 N/A INTRINSIC
Pfam:Fzo_mitofusin 586 756 3.9e-86 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124646
Predicted Effect probably benign
Transcript: ENSMUST00000134172
SMART Domains Protein: ENSMUSP00000123021
Gene: ENSMUSG00000029020

DomainStartEndE-ValueType
Pfam:Dynamin_N 99 208 5.1e-16 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.8%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial membrane protein that participates in mitochondrial fusion and contributes to the maintenance and operation of the mitochondrial network. This protein is involved in the regulation of vascular smooth muscle cell proliferation, and it may play a role in the pathophysiology of obesity. Mutations in this gene cause Charcot-Marie-Tooth disease type 2A2, and hereditary motor and sensory neuropathy VI, which are both disorders of the peripheral nervous system. Defects in this gene have also been associated with early-onset stroke. Two transcript variants encoding the same protein have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene die in mid-gestation. Structural and functional abnormalities of mitochondria are reported. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 C T 1: 130,742,898 P286S possibly damaging Het
Aagab T A 9: 63,619,162 S156T probably damaging Het
Abca14 T G 7: 120,224,419 Y390D probably damaging Het
Abcc2 T A 19: 43,825,947 I1122N possibly damaging Het
Adamts16 T C 13: 70,779,611 E503G possibly damaging Het
Adamts9 A T 6: 92,858,057 C697* probably null Het
Adgrv1 T C 13: 81,474,993 D3837G possibly damaging Het
Aire T A 10: 78,042,599 R128S probably damaging Het
Alkbh2 A C 5: 114,123,950 *240E probably null Het
Als2 T C 1: 59,180,583 Y1191C probably damaging Het
Anapc5 A T 5: 122,814,604 V186E probably benign Het
Apob C T 12: 7,990,307 A548V probably damaging Het
B3galt4 A T 17: 33,950,748 V172E probably damaging Het
Bbs7 A C 3: 36,592,376 C432G possibly damaging Het
Cacna2d3 T A 14: 29,045,644 E758V probably damaging Het
Cactin T G 10: 81,322,662 L154R probably benign Het
Ccdc129 A T 6: 55,898,243 M393L possibly damaging Het
Ccdc88a A C 11: 29,461,021 R502S probably benign Het
Ccnf A T 17: 24,231,810 I398N possibly damaging Het
Chd1 A T 17: 15,768,566 D1527V probably damaging Het
Chd1 A T 17: 15,768,568 M1528L probably benign Het
Chrac1 G A 15: 73,092,826 probably null Het
Cln3 T G 7: 126,583,045 M1L probably damaging Het
Cnot6 T C 11: 49,677,436 Y442C probably damaging Het
Col19a1 A T 1: 24,285,051 probably null Het
Col1a2 T C 6: 4,537,838 F1116L unknown Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cops4 T G 5: 100,528,542 V53G probably damaging Het
Crnkl1 A G 2: 145,919,955 S561P probably benign Het
Ctnnb1 C A 9: 120,951,712 Q99K probably benign Het
Cxcr5 T C 9: 44,513,281 S360G probably benign Het
Dab2 G A 15: 6,418,316 V60M probably damaging Het
Ddx3y A T Y: 1,263,321 Y648* probably null Het
Dennd2a T A 6: 39,497,110 D430V probably damaging Het
Dsp G T 13: 38,192,870 E1544* probably null Het
Efcab7 A T 4: 99,831,394 M38L possibly damaging Het
Fto A G 8: 91,409,527 N141S probably damaging Het
Gabrp A G 11: 33,554,362 F318L probably damaging Het
Gm4737 T A 16: 46,153,883 D377V probably benign Het
Gmeb1 A C 4: 132,242,352 C103W probably damaging Het
Heatr9 T C 11: 83,514,539 D365G probably damaging Het
Hif3a G A 7: 17,044,400 R436W probably benign Het
Hint2 A G 4: 43,654,378 V145A probably damaging Het
Hmcn2 T A 2: 31,423,225 L3482* probably null Het
Hsd3b1 A T 3: 98,853,274 Y134N probably damaging Het
Impg2 T A 16: 56,260,485 V775E probably damaging Het
Ipo5 A G 14: 120,922,223 I154M probably benign Het
Itgad T A 7: 128,198,378 F893Y probably benign Het
Kdm4a T C 4: 118,161,706 R438G probably benign Het
Klk11 T A 7: 43,776,519 M1K probably null Het
Lama5 A T 2: 180,182,426 V2602D possibly damaging Het
Lrch3 T C 16: 32,979,500 S35P probably damaging Het
Mgat4c A T 10: 102,388,704 I260F probably damaging Het
Mon1b T A 8: 113,637,743 S51T probably benign Het
Myh11 T C 16: 14,218,880 D993G probably benign Het
Myo1a A G 10: 127,716,297 N762D probably benign Het
Nacc2 A T 2: 26,060,333 Y464N probably damaging Het
Nckap1 A G 2: 80,553,370 I150T probably benign Het
Ndufv2 G T 17: 66,080,821 P119T probably damaging Het
Noc4l G A 5: 110,652,375 R95* probably null Het
Ntng1 A T 3: 110,135,503 Y2* probably null Het
Olfr1333 A T 4: 118,829,825 V205D possibly damaging Het
Olfr1423 C T 19: 12,036,161 V194I probably benign Het
Olfr1505 C T 19: 13,919,509 T163I probably benign Het
Olfr804 A G 10: 129,705,769 E297G possibly damaging Het
Oog4 T C 4: 143,439,203 N53D probably benign Het
Phkg2 T G 7: 127,573,903 L11R probably damaging Het
Pogz A G 3: 94,870,113 D368G probably damaging Het
Prex2 T A 1: 11,285,065 L1530Q probably damaging Het
Prmt1 C T 7: 44,979,454 E144K probably damaging Het
Prss8 T A 7: 127,927,176 I121F probably benign Het
Psmd13 T C 7: 140,897,711 L314P probably damaging Het
Ptch2 G A 4: 117,108,884 G467D probably damaging Het
Rbm20 C A 19: 53,864,165 P1192Q probably damaging Het
Rpl19 T A 11: 98,028,374 D45E probably benign Het
Rsph10b C T 5: 143,967,128 A219V probably damaging Het
Rtraf C T 14: 19,814,532 probably null Het
Scaf1 T A 7: 45,008,751 T235S probably damaging Het
Shank1 T A 7: 44,319,170 C296S unknown Het
Slc39a7 A T 17: 34,028,950 V426D probably damaging Het
Slc41a2 A T 10: 83,283,746 V384D probably damaging Het
Slco1c1 T C 6: 141,559,773 L475P probably benign Het
Slco6d1 A C 1: 98,490,634 K515T probably benign Het
Sos2 T C 12: 69,635,685 E253G probably damaging Het
Sp6 G T 11: 97,021,535 D25Y possibly damaging Het
Syt11 A C 3: 88,762,548 D12E possibly damaging Het
Taf2 A G 15: 55,047,460 L606P probably damaging Het
Tbc1d5 A G 17: 50,966,736 Y116H probably damaging Het
Tnfrsf8 A G 4: 145,288,459 I243T possibly damaging Het
Tnxb A G 17: 34,698,179 S2183G probably benign Het
Trim66 T C 7: 109,460,172 Y853C probably benign Het
Ttn T A 2: 76,737,495 T27685S probably damaging Het
Ttn T C 2: 76,743,122 E25809G probably damaging Het
Uvssa G A 5: 33,408,847 G445S probably benign Het
Zfp326 T C 5: 105,910,275 S427P probably damaging Het
Zfp592 A G 7: 81,024,889 T534A possibly damaging Het
Zfp672 A G 11: 58,316,347 S383P possibly damaging Het
Zfp799 A G 17: 32,820,726 S188P possibly damaging Het
Zyg11b A C 4: 108,272,253 V54G possibly damaging Het
Other mutations in Mfn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02313:Mfn2 APN 4 147885490 missense probably damaging 1.00
IGL03236:Mfn2 APN 4 147882105 missense probably damaging 1.00
milkshake UTSW 4 147887452 missense probably benign 0.12
R0066:Mfn2 UTSW 4 147885445 unclassified probably benign
R0066:Mfn2 UTSW 4 147885445 unclassified probably benign
R0376:Mfn2 UTSW 4 147885526 missense probably benign 0.24
R0564:Mfn2 UTSW 4 147883255 missense probably damaging 1.00
R0962:Mfn2 UTSW 4 147882201 missense probably benign
R1595:Mfn2 UTSW 4 147894696 missense probably benign 0.08
R2105:Mfn2 UTSW 4 147888705 nonsense probably null
R2260:Mfn2 UTSW 4 147894606 nonsense probably null
R4544:Mfn2 UTSW 4 147887452 missense probably benign 0.12
R4546:Mfn2 UTSW 4 147887452 missense probably benign 0.12
R4561:Mfn2 UTSW 4 147877035 missense probably damaging 1.00
R5151:Mfn2 UTSW 4 147886328 missense probably benign 0.10
R5355:Mfn2 UTSW 4 147894578 missense probably damaging 1.00
R6645:Mfn2 UTSW 4 147894612 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGAAGCTTGGACCTCATTCCCTG -3'
(R):5'- AAAGCCTTGTGTGGATGCTCCGAC -3'

Sequencing Primer
(F):5'- GGCTGTCACTTCCACTCAGG -3'
(R):5'- TTCAAGAATAGTTTCCCCAGGGC -3'
Posted On2013-04-16