Incidental Mutation 'R1665:Dab2ip'
ID258023
Institutional Source Beutler Lab
Gene Symbol Dab2ip
Ensembl Gene ENSMUSG00000026883
Gene Namedisabled 2 interacting protein
Synonyms2310011D08Rik, AIP1
MMRRC Submission 039701-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.455) question?
Stock #R1665 (G1)
Quality Score35
Status Validated
Chromosome2
Chromosomal Location35558266-35730994 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 35720278 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 770 (M770K)
Ref Sequence ENSEMBL: ENSMUSP00000068832 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065001] [ENSMUST00000091010] [ENSMUST00000112983] [ENSMUST00000112986] [ENSMUST00000112987] [ENSMUST00000112992] [ENSMUST00000135741] [ENSMUST00000145698]
Predicted Effect probably damaging
Transcript: ENSMUST00000065001
AA Change: M770K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000068832
Gene: ENSMUSG00000026883
AA Change: M770K

DomainStartEndE-ValueType
PH 10 139 3.63e-2 SMART
C2 149 245 1.34e-7 SMART
RasGAP 255 592 1.08e-126 SMART
low complexity region 604 616 N/A INTRINSIC
Blast:RasGAP 629 694 4e-29 BLAST
low complexity region 733 745 N/A INTRINSIC
low complexity region 780 805 N/A INTRINSIC
low complexity region 855 873 N/A INTRINSIC
coiled coil region 961 1095 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000091010
AA Change: M835K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000088532
Gene: ENSMUSG00000026883
AA Change: M835K

DomainStartEndE-ValueType
low complexity region 13 39 N/A INTRINSIC
PH 73 204 5.58e-3 SMART
C2 214 310 1.34e-7 SMART
RasGAP 320 657 1.08e-126 SMART
low complexity region 669 681 N/A INTRINSIC
Blast:RasGAP 694 759 4e-29 BLAST
low complexity region 798 810 N/A INTRINSIC
low complexity region 845 870 N/A INTRINSIC
low complexity region 920 938 N/A INTRINSIC
coiled coil region 1026 1160 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112981
SMART Domains Protein: ENSMUSP00000108605
Gene: ENSMUSG00000026883

DomainStartEndE-ValueType
Blast:PH 2 80 6e-35 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000112983
AA Change: M711K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000108607
Gene: ENSMUSG00000026883
AA Change: M711K

DomainStartEndE-ValueType
low complexity region 6 18 N/A INTRINSIC
C2 90 186 1.34e-7 SMART
RasGAP 196 533 1.08e-126 SMART
low complexity region 545 557 N/A INTRINSIC
Blast:RasGAP 570 635 3e-29 BLAST
low complexity region 674 686 N/A INTRINSIC
low complexity region 721 746 N/A INTRINSIC
low complexity region 796 814 N/A INTRINSIC
coiled coil region 902 1036 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112986
AA Change: M807K

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108610
Gene: ENSMUSG00000026883
AA Change: M807K

DomainStartEndE-ValueType
PH 45 176 5.58e-3 SMART
C2 186 282 1.34e-7 SMART
RasGAP 292 629 1.08e-126 SMART
low complexity region 641 653 N/A INTRINSIC
Blast:RasGAP 666 731 4e-29 BLAST
low complexity region 770 782 N/A INTRINSIC
low complexity region 817 842 N/A INTRINSIC
low complexity region 892 910 N/A INTRINSIC
coiled coil region 998 1129 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112987
AA Change: M778K

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000108611
Gene: ENSMUSG00000026883
AA Change: M778K

DomainStartEndE-ValueType
PH 16 147 5.58e-3 SMART
C2 157 253 1.34e-7 SMART
RasGAP 263 600 1.08e-126 SMART
low complexity region 612 624 N/A INTRINSIC
Blast:RasGAP 637 702 4e-29 BLAST
low complexity region 741 753 N/A INTRINSIC
low complexity region 788 813 N/A INTRINSIC
low complexity region 863 881 N/A INTRINSIC
coiled coil region 969 1103 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112992
AA Change: M835K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000108616
Gene: ENSMUSG00000026883
AA Change: M835K

DomainStartEndE-ValueType
low complexity region 13 39 N/A INTRINSIC
PH 73 204 5.58e-3 SMART
C2 214 310 1.34e-7 SMART
RasGAP 320 657 1.08e-126 SMART
low complexity region 669 681 N/A INTRINSIC
Blast:RasGAP 694 759 4e-29 BLAST
low complexity region 798 810 N/A INTRINSIC
low complexity region 845 870 N/A INTRINSIC
low complexity region 920 938 N/A INTRINSIC
Pfam:DUF3498 986 1108 3.3e-61 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000124098
AA Change: M728K
SMART Domains Protein: ENSMUSP00000119058
Gene: ENSMUSG00000026883
AA Change: M728K

DomainStartEndE-ValueType
low complexity region 24 36 N/A INTRINSIC
C2 108 204 1.34e-7 SMART
RasGAP 214 551 1.08e-126 SMART
low complexity region 563 575 N/A INTRINSIC
Blast:RasGAP 588 653 3e-29 BLAST
low complexity region 692 704 N/A INTRINSIC
low complexity region 739 764 N/A INTRINSIC
low complexity region 814 832 N/A INTRINSIC
coiled coil region 919 1053 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000135741
AA Change: M778K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000122341
Gene: ENSMUSG00000026883
AA Change: M778K

DomainStartEndE-ValueType
PH 16 147 5.58e-3 SMART
C2 157 253 1.34e-7 SMART
RasGAP 263 600 1.08e-126 SMART
low complexity region 612 624 N/A INTRINSIC
Blast:RasGAP 637 702 4e-29 BLAST
low complexity region 741 753 N/A INTRINSIC
low complexity region 788 813 N/A INTRINSIC
low complexity region 863 881 N/A INTRINSIC
coiled coil region 969 1100 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145698
SMART Domains Protein: ENSMUSP00000114915
Gene: ENSMUSG00000026883

DomainStartEndE-ValueType
Blast:PH 1 79 3e-18 BLAST
low complexity region 80 94 N/A INTRINSIC
low complexity region 118 135 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000156669
AA Change: M438K
SMART Domains Protein: ENSMUSP00000121506
Gene: ENSMUSG00000026883
AA Change: M438K

DomainStartEndE-ValueType
RasGAP 1 283 1.97e-88 SMART
low complexity region 295 307 N/A INTRINSIC
Pfam:DUF3498 317 594 2.9e-78 PFAM
Pfam:DUF3498 591 712 4.2e-70 PFAM
Meta Mutation Damage Score 0.3 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency 100% (87/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DAB2IP is a Ras (MIM 190020) GTPase-activating protein (GAP) that acts as a tumor suppressor. The DAB2IP gene is inactivated by methylation in prostate and breast cancers (Yano et al., 2005 [PubMed 15386433]).[supplied by OMIM, May 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired IRE1-mediated endoplasmic reticulum (ER) stress-induced responses. Mice homozygous for a gene trap allele exhibit delayed Purkinje cell dendritogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 G A 17: 24,377,842 G423E probably damaging Het
Acox3 A T 5: 35,603,027 H429L probably damaging Het
Afg1l T A 10: 42,426,577 K142N probably damaging Het
Aldh1a7 T C 19: 20,727,461 I18V probably benign Het
Angel2 T C 1: 190,937,467 Y115H probably damaging Het
Bsg T G 10: 79,711,518 N261K probably damaging Het
C2cd2l A T 9: 44,316,775 V83E probably benign Het
Caml C A 13: 55,631,971 L286I probably benign Het
Ccdc125 A G 13: 100,693,573 I284V probably benign Het
Ces2a G A 8: 104,737,555 probably benign Het
Cfap61 T C 2: 146,035,319 probably null Het
Creg2 C T 1: 39,623,204 W253* probably null Het
Csmd3 T C 15: 47,696,789 T2293A probably damaging Het
Cttnbp2 A T 6: 18,434,983 I292K probably benign Het
Dct T A 14: 118,034,251 D389V probably damaging Het
Dnah17 A T 11: 118,121,495 probably benign Het
Dnah6 T C 6: 73,124,778 E1921G probably benign Het
Ehmt1 A G 2: 24,877,464 S272P probably damaging Het
Ero1lb T C 13: 12,579,261 probably null Het
Fnip2 A G 3: 79,515,149 F108S probably benign Het
Foxb1 G A 9: 69,759,822 A142V probably damaging Het
Fras1 A T 5: 96,598,909 S613C probably damaging Het
Gm11639 A G 11: 104,721,114 K594R probably benign Het
Gm7276 C A 18: 77,185,570 probably benign Het
Gnb4 A C 3: 32,590,039 L152* probably null Het
H1fnt G T 15: 98,256,915 Q118K probably benign Het
Hdac7 A G 15: 97,806,525 L119P probably damaging Het
Hsd17b4 G A 18: 50,160,215 E274K probably benign Het
Htr4 T C 18: 62,412,234 I30T probably damaging Het
Ikzf2 T A 1: 69,538,814 Y512F probably damaging Het
Itga10 C T 3: 96,651,738 probably benign Het
Klhl22 C A 16: 17,776,488 D160E probably benign Het
Kpna6 T A 4: 129,657,471 R80S probably benign Het
Lclat1 A G 17: 73,188,004 E142G probably damaging Het
Lrig3 T C 10: 125,997,701 Y349H probably benign Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Map1b T A 13: 99,431,929 N1428I unknown Het
Map3k19 T A 1: 127,817,656 T1354S possibly damaging Het
Med13l T A 5: 118,749,748 W1696R probably damaging Het
Mfn1 T G 3: 32,534,322 V66G probably benign Het
Mllt10 A T 2: 18,208,790 Q459L possibly damaging Het
Morc2a G A 11: 3,675,885 V162M probably benign Het
Muc15 C T 2: 110,733,898 Q260* probably null Het
Nfkb1 T C 3: 135,594,957 H616R probably damaging Het
Nr2c1 T A 10: 94,188,183 W417R probably damaging Het
Olfr1279 T C 2: 111,306,771 C189R probably damaging Het
Olfr1285 T C 2: 111,408,753 Y113H probably damaging Het
Olfr1480 A T 19: 13,529,838 H99L probably damaging Het
Olfr250 C T 9: 38,367,566 H7Y probably benign Het
Olfr541 G T 7: 140,704,794 C181F probably damaging Het
Olfr714 T C 7: 107,074,274 S149P probably damaging Het
Pde10a A G 17: 8,898,870 D26G probably damaging Het
Pi15 G T 1: 17,621,502 C176F probably damaging Het
Pou2f2 T A 7: 25,092,724 T569S possibly damaging Het
Prf1 A C 10: 61,302,887 E208A probably benign Het
Prkd1 G A 12: 50,394,926 H277Y probably damaging Het
Rc3h1 T A 1: 160,959,423 V796E probably benign Het
Rgl1 T C 1: 152,533,575 Y503C probably damaging Het
Ripk3 T A 14: 55,786,351 H1L probably benign Het
Ryr1 C T 7: 29,036,078 D4064N probably damaging Het
Sec63 T A 10: 42,798,728 probably null Het
Slco1a4 T G 6: 141,839,577 M96L possibly damaging Het
Slit3 A T 11: 35,234,906 R137S possibly damaging Het
Smad1 T C 8: 79,372,029 E52G probably damaging Het
Srd5a2 A T 17: 74,021,481 W201R probably damaging Het
Steap1 A T 5: 5,736,498 L313Q probably damaging Het
Syt2 C A 1: 134,747,620 A403D probably damaging Het
Tax1bp1 T A 6: 52,736,912 S225R probably benign Het
Thap3 C T 4: 151,985,704 V78M probably damaging Het
Thoc5 A G 11: 4,919,792 K446R probably benign Het
Timmdc1 A C 16: 38,510,717 probably null Het
Tm6sf2 G T 8: 70,078,930 probably benign Het
Tmem126b G T 7: 90,475,971 A2E probably damaging Het
Trim9 T A 12: 70,255,113 R584W probably damaging Het
Ttn C A 2: 76,830,856 probably benign Het
Vmn1r25 A T 6: 57,978,461 I281N probably damaging Het
Wdr59 A G 8: 111,479,362 F553S probably damaging Het
Zc3h4 A G 7: 16,429,580 M575V unknown Het
Zfp53 A G 17: 21,509,504 T600A probably damaging Het
Zic5 A G 14: 122,459,527 S559P unknown Het
Other mutations in Dab2ip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Dab2ip APN 2 35720013 missense probably damaging 1.00
IGL00799:Dab2ip APN 2 35707775 missense probably benign 0.25
IGL00902:Dab2ip APN 2 35717112 missense probably damaging 1.00
IGL00929:Dab2ip APN 2 35708877 missense possibly damaging 0.91
IGL03052:Dab2ip UTSW 2 35643897 missense probably benign 0.27
R0097:Dab2ip UTSW 2 35718916 missense possibly damaging 0.95
R0137:Dab2ip UTSW 2 35692376 critical splice donor site probably null
R0184:Dab2ip UTSW 2 35718791 missense probably damaging 1.00
R1195:Dab2ip UTSW 2 35718745 splice site probably benign
R1195:Dab2ip UTSW 2 35718745 splice site probably benign
R1388:Dab2ip UTSW 2 35721256 intron probably benign
R1442:Dab2ip UTSW 2 35710256 missense probably damaging 0.97
R1496:Dab2ip UTSW 2 35718791 missense probably damaging 1.00
R1909:Dab2ip UTSW 2 35718815 missense probably damaging 1.00
R3625:Dab2ip UTSW 2 35643891 nonsense probably null
R3819:Dab2ip UTSW 2 35713210 missense probably damaging 1.00
R4333:Dab2ip UTSW 2 35661620 makesense probably null
R4869:Dab2ip UTSW 2 35720037 missense probably damaging 1.00
R4894:Dab2ip UTSW 2 35730527 utr 3 prime probably benign
R5035:Dab2ip UTSW 2 35709941 missense probably benign 0.03
R5180:Dab2ip UTSW 2 35720491 missense possibly damaging 0.83
R5425:Dab2ip UTSW 2 35709991 missense probably benign 0.25
R5513:Dab2ip UTSW 2 35710254 missense probably benign 0.11
R5579:Dab2ip UTSW 2 35715327 nonsense probably null
R5829:Dab2ip UTSW 2 35707775 unclassified probably benign
R5840:Dab2ip UTSW 2 35727499 missense probably damaging 0.98
R5890:Dab2ip UTSW 2 35715402 missense probably damaging 1.00
R6057:Dab2ip UTSW 2 35692255 nonsense probably null
R6235:Dab2ip UTSW 2 35723087 missense probably damaging 1.00
R6360:Dab2ip UTSW 2 35710266 missense probably benign 0.38
R6571:Dab2ip UTSW 2 35712890 missense probably damaging 1.00
R6813:Dab2ip UTSW 2 35730473 nonsense probably null
X0011:Dab2ip UTSW 2 35723085 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTCAGAAGCCAATGAACCTGACCTG -3'
(R):5'- GCACTATTTTGCCTCGGCACTGTG -3'

Sequencing Primer
(F):5'- ATGGTGGACCTCCAGGAC -3'
(R):5'- TCAGTCAGTGACATCTGCC -3'
Posted On2015-01-14