Incidental Mutation 'R1717:Aldh4a1'
ID258039
Institutional Source Beutler Lab
Gene Symbol Aldh4a1
Ensembl Gene ENSMUSG00000028737
Gene Namealdehyde dehydrogenase 4 family, member A1
SynonymsP5CDH, Ssdh1, A930035F14Rik, ALDH4, Ahd1, Ahd-1
MMRRC Submission 039750-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R1717 (G1)
Quality Score66
Status Validated
Chromosome4
Chromosomal Location139622866-139649690 bp(+) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) G to A at 139633994 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000043821 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039818] [ENSMUST00000039818] [ENSMUST00000178644] [ENSMUST00000178644]
PDB Structure
Crystal structure of mouse 1-pyrroline-5-carboxylate dehydrogenase complexed with sulfate ion [X-RAY DIFFRACTION]
Crystal structure of mouse 1-pyrroline-5-carboxylate dehydrogenase complexed with the product glutamate [X-RAY DIFFRACTION]
Crystal structure of mouse 1-pyrroline-5-carboxylate dehydrogenase complexed with NAD+ [X-RAY DIFFRACTION]
Crystal Structure of Mus musculus 1-pyrroline-5-carboxylate dehydrogenase cryoprotected in proline [X-RAY DIFFRACTION]
Structure of mouse 1-Pyrroline-5-Carboxylate Dehydrogenase (ALDH4A1) complexed with acetate [X-RAY DIFFRACTION]
Structure of mouse 1-Pyrroline-5-Carboxylate Dehydrogenase (ALDH4A1) complexed with glyoxylate [X-RAY DIFFRACTION]
Structure of mouse 1-Pyrroline-5-Carboxylate Dehydrogenase (ALDH4A1) complexed with malonate [X-RAY DIFFRACTION]
Structure of mouse 1-Pyrroline-5-Carboxylate Dehydrogenase (ALDH4A1) complexed with succinate [X-RAY DIFFRACTION]
Structure of mouse 1-Pyrroline-5-Carboxylate Dehydrogenase (ALDH4A1) complexed with glutarate [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000039818
SMART Domains Protein: ENSMUSP00000043821
Gene: ENSMUSG00000028737

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:Aldedh 73 546 7.6e-104 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000039818
SMART Domains Protein: ENSMUSP00000043821
Gene: ENSMUSG00000028737

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:Aldedh 73 546 7.6e-104 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124987
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146309
Predicted Effect probably benign
Transcript: ENSMUST00000178644
SMART Domains Protein: ENSMUSP00000136776
Gene: ENSMUSG00000094439

DomainStartEndE-ValueType
SCOP:d1lbva_ 1 60 5e-3 SMART
Pfam:Filament 165 253 7.3e-13 PFAM
low complexity region 255 268 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178644
SMART Domains Protein: ENSMUSP00000136776
Gene: ENSMUSG00000094439

DomainStartEndE-ValueType
SCOP:d1lbva_ 1 60 5e-3 SMART
Pfam:Filament 165 253 7.3e-13 PFAM
low complexity region 255 268 N/A INTRINSIC
Meta Mutation Damage Score 0.6324 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 98% (81/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein belongs to the aldehyde dehydrogenase family of proteins. This enzyme is a mitochondrial matrix NAD-dependent dehydrogenase which catalyzes the second step of the proline degradation pathway, converting pyrroline-5-carboxylate to glutamate. Deficiency of this enzyme is associated with type II hyperprolinemia, an autosomal recessive disorder characterized by accumulation of delta-1-pyrroline-5-carboxylate (P5C) and proline. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,751,664 D616G probably damaging Het
4732465J04Rik GATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCT GATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCT 10: 95,793,779 probably null Het
4930583I09Rik T C 17: 64,834,449 N53S unknown Het
4933434E20Rik T A 3: 90,056,237 S67T probably benign Het
9230019H11Rik A T 10: 3,125,050 noncoding transcript Het
Abcc8 T C 7: 46,115,815 I1127V possibly damaging Het
Abcg3 G A 5: 104,963,555 Q349* probably null Het
Adam2 A G 14: 66,068,558 L158P probably damaging Het
Agrn GCTCT GCTCTCT 4: 156,166,519 probably null Het
Agrp G T 8: 105,566,835 T106K probably damaging Het
Akap11 C A 14: 78,513,348 S533I probably benign Het
Aldh1a2 A T 9: 71,293,671 N517I probably damaging Het
Ankrd27 A G 7: 35,628,446 D742G possibly damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Arhgef7 C A 8: 11,808,712 probably benign Het
Arhgef7 C A 8: 11,808,713 probably null Het
Arvcf A G 16: 18,401,569 K568E possibly damaging Het
Atp8b3 G A 10: 80,528,797 R521W probably damaging Het
Casp16-ps A G 17: 23,552,050 I127T possibly damaging Het
Cd163 A G 6: 124,329,588 probably benign Het
Cdh8 A T 8: 99,030,705 S754T probably damaging Het
Cel A G 2: 28,556,777 Y461H probably damaging Het
Chmp4b A G 2: 154,657,320 I47V possibly damaging Het
Col1a1 A G 11: 94,948,392 M989V unknown Het
Cpsf1 A T 15: 76,602,566 S257T possibly damaging Het
Csmd1 A T 8: 17,216,692 S73T possibly damaging Het
Csnk2a2 T C 8: 95,455,808 probably null Het
Dact2 A T 17: 14,197,913 W177R probably benign Het
Ddx10 A G 9: 53,159,953 V680A probably benign Het
Eif5 T A 12: 111,542,217 D215E probably benign Het
Evpl C T 11: 116,225,492 A817T probably benign Het
Fmo6 T A 1: 162,926,252 R131* probably null Het
Fsd2 T C 7: 81,535,109 T680A probably benign Het
Fsip2 T C 2: 82,974,945 V536A possibly damaging Het
Fzd8 T C 18: 9,214,364 F482S probably damaging Het
Gabrb1 A T 5: 72,108,351 probably null Het
Galnt9 T G 5: 110,596,212 I304S probably benign Het
Glra3 G T 8: 55,940,907 A18S probably benign Het
Gm5334 A C 7: 68,618,977 noncoding transcript Het
Grcc10 A T 6: 124,740,513 probably benign Het
Hmcn1 T C 1: 150,859,186 T192A probably damaging Het
Ip6k1 G A 9: 108,040,996 E77K possibly damaging Het
Irgm2 T A 11: 58,220,635 L396Q probably damaging Het
Ksr2 T A 5: 117,671,449 C426S probably damaging Het
Lair1 A G 7: 4,010,789 F153S probably damaging Het
Lrp1 T C 10: 127,556,269 H2835R possibly damaging Het
Lrp1 T C 10: 127,563,665 T2325A probably damaging Het
Lrrd1 T C 5: 3,850,580 F295S probably damaging Het
Meis1 T A 11: 19,010,608 probably benign Het
Mkln1 T A 6: 31,507,644 I156K probably benign Het
Mmd2 T C 5: 142,575,350 probably benign Het
Morc1 A G 16: 48,452,477 I156V probably benign Het
Muc4 A G 16: 32,753,405 T1094A possibly damaging Het
Nckap1 A G 2: 80,512,670 probably benign Het
Neb A G 2: 52,308,747 I394T possibly damaging Het
Olfr1111 A T 2: 87,149,806 L285* probably null Het
Olfr1112 A T 2: 87,191,903 N72I probably benign Het
Olfr1509 T C 14: 52,450,839 V142A probably benign Het
Olfr331 T A 11: 58,502,059 M166L probably benign Het
Olfr933 C T 9: 38,976,410 L245F probably damaging Het
Pcdha1 T C 18: 36,932,184 S634P probably benign Het
Pcdhb12 T A 18: 37,436,788 V329E probably damaging Het
Pcf11 A T 7: 92,663,585 D193E probably benign Het
Pcsk1 G C 13: 75,110,828 M240I probably damaging Het
Pdc T A 1: 150,333,141 I125N probably damaging Het
Plch2 C T 4: 154,998,272 G564S probably benign Het
Rasgrf1 G T 9: 89,953,913 Q231H probably damaging Het
Riok1 T A 13: 38,052,950 I389N probably damaging Het
Ror1 T A 4: 100,302,938 S50R probably benign Het
Samd13 T C 3: 146,646,315 T75A probably benign Het
Siglec1 G A 2: 131,073,956 H1329Y possibly damaging Het
Siglec1 T C 2: 131,084,012 N258S probably damaging Het
Slbp G A 5: 33,645,602 A126V probably benign Het
Slc12a4 A T 8: 105,947,571 probably null Het
Specc1 A G 11: 62,128,392 I686V possibly damaging Het
Synpo2 C A 3: 123,112,554 V1038F probably damaging Het
Tbk1 G A 10: 121,561,645 T374I probably benign Het
Tktl2 G A 8: 66,512,347 V186M probably damaging Het
Tmem190 T C 7: 4,784,133 L112P probably damaging Het
Tsc2 C T 17: 24,597,068 R1715Q probably damaging Het
Vmn1r46 T C 6: 89,976,829 L220P probably damaging Het
Vwa3a A G 7: 120,793,386 Q816R probably benign Het
Zfhx4 T C 3: 5,403,104 I2799T probably benign Het
Zfp105 T C 9: 122,930,631 S456P probably damaging Het
Other mutations in Aldh4a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01732:Aldh4a1 APN 4 139642160 nonsense probably null
IGL01916:Aldh4a1 APN 4 139644146 missense probably damaging 1.00
IGL02368:Aldh4a1 APN 4 139648200 nonsense probably null
IGL02469:Aldh4a1 APN 4 139648161 missense probably damaging 0.98
PIT4402001:Aldh4a1 UTSW 4 139642191 nonsense probably null
R0511:Aldh4a1 UTSW 4 139642571 splice site probably benign
R1352:Aldh4a1 UTSW 4 139635519 missense probably benign 0.18
R1484:Aldh4a1 UTSW 4 139643447 missense probably benign 0.00
R1717:Aldh4a1 UTSW 4 139638529 missense possibly damaging 0.93
R1729:Aldh4a1 UTSW 4 139644161 missense probably damaging 1.00
R1784:Aldh4a1 UTSW 4 139644161 missense probably damaging 1.00
R1785:Aldh4a1 UTSW 4 139644128 missense probably benign 0.01
R1786:Aldh4a1 UTSW 4 139644128 missense probably benign 0.01
R3696:Aldh4a1 UTSW 4 139642251 missense possibly damaging 0.68
R3697:Aldh4a1 UTSW 4 139642251 missense possibly damaging 0.68
R3698:Aldh4a1 UTSW 4 139642251 missense possibly damaging 0.68
R4603:Aldh4a1 UTSW 4 139643429 missense probably damaging 0.97
R5197:Aldh4a1 UTSW 4 139648301 intron probably benign
R5375:Aldh4a1 UTSW 4 139633922 missense probably benign
R5539:Aldh4a1 UTSW 4 139638522 missense probably benign 0.05
R5590:Aldh4a1 UTSW 4 139642104 missense probably damaging 1.00
R6101:Aldh4a1 UTSW 4 139638495 missense possibly damaging 0.91
R6105:Aldh4a1 UTSW 4 139638495 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- GGTGACCAATGAGCCCATCTTAGC -3'
(R):5'- TTTGGACATGCCTCAGGAATGGAC -3'

Sequencing Primer
(F):5'- TTAGCATTCTCTCAGGGAAGC -3'
(R):5'- ATGGACCGTGAGTGGCAC -3'
Posted On2015-01-22