Incidental Mutation 'R3160:1700074P13Rik'
ID258099
Institutional Source Beutler Lab
Gene Symbol 1700074P13Rik
Ensembl Gene ENSMUSG00000029883
Gene NameRIKEN cDNA 1700074P13 gene
Synonyms
MMRRC Submission 040611-MU
Accession Numbers

Ncbi RefSeq: NM_028550.3; MGI: 1920731

Is this an essential gene? Probably non essential (E-score: 0.026) question?
Stock #R3160 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location40920437-40940557 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 40926069 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 123 (M123T)
Ref Sequence ENSEMBL: ENSMUSP00000116538 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031935] [ENSMUST00000122181] [ENSMUST00000136499]
Predicted Effect probably benign
Transcript: ENSMUST00000031935
AA Change: M123T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000031935
Gene: ENSMUSG00000029883
AA Change: M123T

DomainStartEndE-ValueType
Tryp_SPc 24 244 4.27e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122181
AA Change: M123T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000112987
Gene: ENSMUSG00000029883
AA Change: M123T

DomainStartEndE-ValueType
Tryp_SPc 24 244 4.27e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136499
AA Change: M123T

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000116538
Gene: ENSMUSG00000029883
AA Change: M123T

DomainStartEndE-ValueType
Tryp_SPc 24 174 6.08e-5 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency
Allele List at MGI

All alleles(1) : Targeted(1)

Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy9 A G 16: 4,311,588 L715P probably damaging Het
Amer2 A G 14: 60,378,551 D65G probably damaging Het
Btnl2 T C 17: 34,358,065 W65R probably damaging Het
Camk1g T C 1: 193,359,807 T45A possibly damaging Het
Ccdc181 T A 1: 164,280,296 S183T probably damaging Het
Cep350 T C 1: 155,863,164 H2311R probably benign Het
Copa T A 1: 172,091,233 C127S probably damaging Het
Crbn T C 6: 106,790,866 Q221R probably benign Het
Dapk2 T G 9: 66,254,611 V267G probably damaging Het
Decr1 T A 4: 15,930,972 D120V probably damaging Het
Dennd1c C T 17: 57,066,562 G637D possibly damaging Het
Disp1 T C 1: 183,087,242 K1205E probably benign Het
Dnajc13 G T 9: 104,219,898 N510K possibly damaging Het
Hnrnpu T C 1: 178,331,125 probably benign Het
Iqgap1 G A 7: 80,752,338 A393V probably benign Het
Irak2 G T 6: 113,672,760 A119S probably benign Het
Itgb2l A G 16: 96,437,389 L70P probably damaging Het
Itsn1 C A 16: 91,853,044 S202* probably null Het
Mill2 A C 7: 18,856,174 E127A probably benign Het
Msh6 T C 17: 87,985,481 Y555H probably damaging Het
Myo18b A C 5: 112,692,728 S2400A probably damaging Het
Naa25 A G 5: 121,435,072 probably null Het
Nop2 A G 6: 125,134,592 N96S probably benign Het
Olfr1263 T G 2: 90,015,021 Y30* probably null Het
Olfr156 T A 4: 43,820,544 K272N probably benign Het
Olfr30 T C 11: 58,455,227 T241A probably damaging Het
Olfr739 T A 14: 50,425,031 C171S probably damaging Het
Pde5a T A 3: 122,781,628 L356* probably null Het
Ralgapa1 A T 12: 55,709,586 N1075K probably damaging Het
Rps2 G T 17: 24,720,978 A129S probably benign Het
Serinc2 A G 4: 130,260,735 S175P probably benign Het
Socs5 A T 17: 87,134,718 Q362L probably damaging Het
Srbd1 A T 17: 86,130,215 D233E probably benign Het
Srgap3 A G 6: 112,729,658 V826A probably benign Het
Tns2 A G 15: 102,113,336 E1118G possibly damaging Het
Topaz1 T C 9: 122,749,381 I452T probably benign Het
Tuba8 A G 6: 121,222,738 D127G possibly damaging Het
Tulp4 A G 17: 6,198,708 M1V probably null Het
Urb1 A G 16: 90,797,903 L247P probably damaging Het
Usp32 A G 11: 85,025,536 W861R probably damaging Het
Vmn1r48 G A 6: 90,036,378 T155I probably benign Het
Vmn2r117 A G 17: 23,460,378 L624P probably damaging Het
Vstm5 T G 9: 15,257,298 S53A probably benign Het
Yeats2 T C 16: 20,193,645 V531A probably damaging Het
Other mutations in 1700074P13Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03151:1700074P13Rik APN 6 40926012 missense probably damaging 1.00
R0041:1700074P13Rik UTSW 6 40926108 nonsense probably null
R0041:1700074P13Rik UTSW 6 40926108 nonsense probably null
R0686:1700074P13Rik UTSW 6 40928518 missense probably damaging 0.99
R0799:1700074P13Rik UTSW 6 40928599 missense probably damaging 0.97
R1250:1700074P13Rik UTSW 6 40925975 critical splice donor site probably null
R1499:1700074P13Rik UTSW 6 40921718 missense probably benign 0.26
R1678:1700074P13Rik UTSW 6 40929519 start gained probably benign
R1755:1700074P13Rik UTSW 6 40926162 missense probably damaging 0.99
R1891:1700074P13Rik UTSW 6 40926033 missense possibly damaging 0.73
R3162:1700074P13Rik UTSW 6 40926069 missense probably benign 0.05
R4194:1700074P13Rik UTSW 6 40921071 missense probably damaging 1.00
R4750:1700074P13Rik UTSW 6 40921021 missense probably damaging 1.00
R6197:1700074P13Rik UTSW 6 40921005 missense probably benign 0.05
R6217:1700074P13Rik UTSW 6 40926085 missense possibly damaging 0.88
R6394:1700074P13Rik UTSW 6 40921792 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GAGGCCAAGTCTTGCTGGTA -3'
(R):5'- GACATTCAGTGACTGTTTTCTCTTCC -3'

Sequencing Primer
(F):5'- GGCCAAGTCTTGCTGGTAATCAC -3'
(R):5'- AGTGACTGTTTTCTCTTCCATCTC -3'
Posted On2015-01-23