Incidental Mutation 'R3160:Olfr739'
ID258120
Institutional Source Beutler Lab
Gene Symbol Olfr739
Ensembl Gene ENSMUSG00000057903
Gene Nameolfactory receptor 739
SynonymsMOR106-2, GA_x6K02T2PMLR-6121675-6122604
MMRRC Submission 040611-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R3160 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location50418626-50427888 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 50425031 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 171 (C171S)
Ref Sequence ENSEMBL: ENSMUSP00000150559 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075261] [ENSMUST00000216949]
Predicted Effect probably damaging
Transcript: ENSMUST00000075261
AA Change: C171S

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000074740
Gene: ENSMUSG00000057903
AA Change: C171S

DomainStartEndE-ValueType
Pfam:7tm_4 33 309 1.1e-53 PFAM
Pfam:7tm_1 43 292 1.9e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216949
AA Change: C171S

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Meta Mutation Damage Score 0.492 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A G 6: 40,926,069 M123T probably benign Het
Adcy9 A G 16: 4,311,588 L715P probably damaging Het
Amer2 A G 14: 60,378,551 D65G probably damaging Het
Btnl2 T C 17: 34,358,065 W65R probably damaging Het
Camk1g T C 1: 193,359,807 T45A possibly damaging Het
Ccdc181 T A 1: 164,280,296 S183T probably damaging Het
Cep350 T C 1: 155,863,164 H2311R probably benign Het
Copa T A 1: 172,091,233 C127S probably damaging Het
Crbn T C 6: 106,790,866 Q221R probably benign Het
Dapk2 T G 9: 66,254,611 V267G probably damaging Het
Decr1 T A 4: 15,930,972 D120V probably damaging Het
Dennd1c C T 17: 57,066,562 G637D possibly damaging Het
Disp1 T C 1: 183,087,242 K1205E probably benign Het
Dnajc13 G T 9: 104,219,898 N510K possibly damaging Het
Hnrnpu T C 1: 178,331,125 probably benign Het
Iqgap1 G A 7: 80,752,338 A393V probably benign Het
Irak2 G T 6: 113,672,760 A119S probably benign Het
Itgb2l A G 16: 96,437,389 L70P probably damaging Het
Itsn1 C A 16: 91,853,044 S202* probably null Het
Mill2 A C 7: 18,856,174 E127A probably benign Het
Msh6 T C 17: 87,985,481 Y555H probably damaging Het
Myo18b A C 5: 112,692,728 S2400A probably damaging Het
Naa25 A G 5: 121,435,072 probably null Het
Nop2 A G 6: 125,134,592 N96S probably benign Het
Olfr1263 T G 2: 90,015,021 Y30* probably null Het
Olfr156 T A 4: 43,820,544 K272N probably benign Het
Olfr30 T C 11: 58,455,227 T241A probably damaging Het
Pde5a T A 3: 122,781,628 L356* probably null Het
Ralgapa1 A T 12: 55,709,586 N1075K probably damaging Het
Rps2 G T 17: 24,720,978 A129S probably benign Het
Serinc2 A G 4: 130,260,735 S175P probably benign Het
Socs5 A T 17: 87,134,718 Q362L probably damaging Het
Srbd1 A T 17: 86,130,215 D233E probably benign Het
Srgap3 A G 6: 112,729,658 V826A probably benign Het
Tns2 A G 15: 102,113,336 E1118G possibly damaging Het
Topaz1 T C 9: 122,749,381 I452T probably benign Het
Tuba8 A G 6: 121,222,738 D127G possibly damaging Het
Tulp4 A G 17: 6,198,708 M1V probably null Het
Urb1 A G 16: 90,797,903 L247P probably damaging Het
Usp32 A G 11: 85,025,536 W861R probably damaging Het
Vmn1r48 G A 6: 90,036,378 T155I probably benign Het
Vmn2r117 A G 17: 23,460,378 L624P probably damaging Het
Vstm5 T G 9: 15,257,298 S53A probably benign Het
Yeats2 T C 16: 20,193,645 V531A probably damaging Het
Other mutations in Olfr739
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01719:Olfr739 APN 14 50424561 missense possibly damaging 0.88
IGL02430:Olfr739 APN 14 50425151 missense probably benign
IGL02603:Olfr739 APN 14 50425200 missense probably damaging 1.00
IGL02959:Olfr739 APN 14 50424932 missense possibly damaging 0.76
IGL03154:Olfr739 APN 14 50424623 missense probably benign 0.00
R0455:Olfr739 UTSW 14 50424902 missense possibly damaging 0.45
R1984:Olfr739 UTSW 14 50425391 missense possibly damaging 0.93
R3161:Olfr739 UTSW 14 50425031 missense probably damaging 0.99
R3162:Olfr739 UTSW 14 50425031 missense probably damaging 0.99
R4821:Olfr739 UTSW 14 50424749 missense possibly damaging 0.96
R4880:Olfr739 UTSW 14 50425301 missense possibly damaging 0.90
R5047:Olfr739 UTSW 14 50425239 missense probably damaging 1.00
R5384:Olfr739 UTSW 14 50425389 missense possibly damaging 0.77
R5385:Olfr739 UTSW 14 50425389 missense possibly damaging 0.77
R5386:Olfr739 UTSW 14 50425389 missense possibly damaging 0.77
R5640:Olfr739 UTSW 14 50424654 missense probably benign 0.18
R5809:Olfr739 UTSW 14 50425448 makesense probably null
R6035:Olfr739 UTSW 14 50424527 missense probably benign
R6035:Olfr739 UTSW 14 50424527 missense probably benign
R6229:Olfr739 UTSW 14 50425205 missense probably benign 0.38
R6614:Olfr739 UTSW 14 50425089 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCTCCTTGGGTTCTACAGAATGC -3'
(R):5'- ATCCGCAAGTGGAGAAAGCC -3'

Sequencing Primer
(F):5'- ACAGAATGCTTTTTCCTGGCAG -3'
(R):5'- GTCCATCTCTTGAAGGAACTCTGAAC -3'
Posted On2015-01-23