Incidental Mutation 'R3160:Amer2'
ID258121
Institutional Source Beutler Lab
Gene Symbol Amer2
Ensembl Gene ENSMUSG00000021986
Gene NameAPC membrane recruitment 2
SynonymsFam123a, 2600011E07Rik, Amer2
MMRRC Submission 040611-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.284) question?
Stock #R3160 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location60373259-60388197 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 60378551 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 65 (D65G)
Ref Sequence ENSEMBL: ENSMUSP00000152965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022561] [ENSMUST00000224957] [ENSMUST00000225247]
Predicted Effect probably damaging
Transcript: ENSMUST00000022561
AA Change: D65G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022561
Gene: ENSMUSG00000021986
AA Change: D65G

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
Pfam:WTX 57 554 5.2e-199 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000224957
AA Change: D65G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect possibly damaging
Transcript: ENSMUST00000225247
AA Change: D65G

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
Meta Mutation Damage Score 0.276 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A G 6: 40,926,069 M123T probably benign Het
Adcy9 A G 16: 4,311,588 L715P probably damaging Het
Btnl2 T C 17: 34,358,065 W65R probably damaging Het
Camk1g T C 1: 193,359,807 T45A possibly damaging Het
Ccdc181 T A 1: 164,280,296 S183T probably damaging Het
Cep350 T C 1: 155,863,164 H2311R probably benign Het
Copa T A 1: 172,091,233 C127S probably damaging Het
Crbn T C 6: 106,790,866 Q221R probably benign Het
Dapk2 T G 9: 66,254,611 V267G probably damaging Het
Decr1 T A 4: 15,930,972 D120V probably damaging Het
Dennd1c C T 17: 57,066,562 G637D possibly damaging Het
Disp1 T C 1: 183,087,242 K1205E probably benign Het
Dnajc13 G T 9: 104,219,898 N510K possibly damaging Het
Hnrnpu T C 1: 178,331,125 probably benign Het
Iqgap1 G A 7: 80,752,338 A393V probably benign Het
Irak2 G T 6: 113,672,760 A119S probably benign Het
Itgb2l A G 16: 96,437,389 L70P probably damaging Het
Itsn1 C A 16: 91,853,044 S202* probably null Het
Mill2 A C 7: 18,856,174 E127A probably benign Het
Msh6 T C 17: 87,985,481 Y555H probably damaging Het
Myo18b A C 5: 112,692,728 S2400A probably damaging Het
Naa25 A G 5: 121,435,072 probably null Het
Nop2 A G 6: 125,134,592 N96S probably benign Het
Olfr1263 T G 2: 90,015,021 Y30* probably null Het
Olfr156 T A 4: 43,820,544 K272N probably benign Het
Olfr30 T C 11: 58,455,227 T241A probably damaging Het
Olfr739 T A 14: 50,425,031 C171S probably damaging Het
Pde5a T A 3: 122,781,628 L356* probably null Het
Ralgapa1 A T 12: 55,709,586 N1075K probably damaging Het
Rps2 G T 17: 24,720,978 A129S probably benign Het
Serinc2 A G 4: 130,260,735 S175P probably benign Het
Socs5 A T 17: 87,134,718 Q362L probably damaging Het
Srbd1 A T 17: 86,130,215 D233E probably benign Het
Srgap3 A G 6: 112,729,658 V826A probably benign Het
Tns2 A G 15: 102,113,336 E1118G possibly damaging Het
Topaz1 T C 9: 122,749,381 I452T probably benign Het
Tuba8 A G 6: 121,222,738 D127G possibly damaging Het
Tulp4 A G 17: 6,198,708 M1V probably null Het
Urb1 A G 16: 90,797,903 L247P probably damaging Het
Usp32 A G 11: 85,025,536 W861R probably damaging Het
Vmn1r48 G A 6: 90,036,378 T155I probably benign Het
Vmn2r117 A G 17: 23,460,378 L624P probably damaging Het
Vstm5 T G 9: 15,257,298 S53A probably benign Het
Yeats2 T C 16: 20,193,645 V531A probably damaging Het
Other mutations in Amer2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01844:Amer2 APN 14 60379907 missense possibly damaging 0.82
IGL03306:Amer2 APN 14 60378552 missense probably damaging 1.00
IGL03382:Amer2 APN 14 60379882 missense possibly damaging 0.77
R0365:Amer2 UTSW 14 60379535 missense probably damaging 0.99
R0433:Amer2 UTSW 14 60378583 missense probably damaging 0.99
R1696:Amer2 UTSW 14 60379674 missense possibly damaging 0.93
R1754:Amer2 UTSW 14 60379757 missense probably damaging 1.00
R1991:Amer2 UTSW 14 60379820 missense probably damaging 0.96
R2018:Amer2 UTSW 14 60378445 missense probably damaging 1.00
R2423:Amer2 UTSW 14 60379207 missense possibly damaging 0.81
R3161:Amer2 UTSW 14 60378551 missense probably damaging 1.00
R3162:Amer2 UTSW 14 60378551 missense probably damaging 1.00
R4928:Amer2 UTSW 14 60379445 missense possibly damaging 0.92
R4981:Amer2 UTSW 14 60379727 missense probably damaging 1.00
R5212:Amer2 UTSW 14 60379820 missense probably damaging 0.96
R5535:Amer2 UTSW 14 60378853 small deletion probably benign
R5685:Amer2 UTSW 14 60379577 nonsense probably null
R6002:Amer2 UTSW 14 60378782 missense possibly damaging 0.93
R6247:Amer2 UTSW 14 60378872 missense probably damaging 0.96
R6408:Amer2 UTSW 14 60380225 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ACATGGACTCGCATTGTGAG -3'
(R):5'- TGCTGAAGATCCCTTTCAGC -3'

Sequencing Primer
(F):5'- CTCGCATTGTGAGTGCGC -3'
(R):5'- CGTTCTTTTTCAGCAGGGAGAAGAAG -3'
Posted On2015-01-23