Incidental Mutation 'R3160:Adcy9'
ID258124
Institutional Source Beutler Lab
Gene Symbol Adcy9
Ensembl Gene ENSMUSG00000005580
Gene Nameadenylate cyclase 9
SynonymsD16Wsu65e, ACtp10
MMRRC Submission 040611-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.576) question?
Stock #R3160 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location4287529-4420498 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4311588 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 715 (L715P)
Ref Sequence ENSEMBL: ENSMUSP00000113498 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005719] [ENSMUST00000117801] [ENSMUST00000120080]
Predicted Effect probably damaging
Transcript: ENSMUST00000005719
AA Change: L715P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000005719
Gene: ENSMUSG00000005580
AA Change: L715P

DomainStartEndE-ValueType
low complexity region 6 13 N/A INTRINSIC
low complexity region 49 75 N/A INTRINSIC
transmembrane domain 118 137 N/A INTRINSIC
transmembrane domain 142 164 N/A INTRINSIC
transmembrane domain 177 196 N/A INTRINSIC
transmembrane domain 216 235 N/A INTRINSIC
transmembrane domain 242 261 N/A INTRINSIC
transmembrane domain 281 300 N/A INTRINSIC
CYCc 325 547 1.69e-63 SMART
transmembrane domain 791 813 N/A INTRINSIC
transmembrane domain 823 845 N/A INTRINSIC
transmembrane domain 858 880 N/A INTRINSIC
transmembrane domain 890 912 N/A INTRINSIC
transmembrane domain 977 996 N/A INTRINSIC
CYCc 1023 1227 1.26e-39 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000117801
AA Change: L715P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113498
Gene: ENSMUSG00000005580
AA Change: L715P

DomainStartEndE-ValueType
low complexity region 6 13 N/A INTRINSIC
low complexity region 49 75 N/A INTRINSIC
transmembrane domain 118 137 N/A INTRINSIC
transmembrane domain 142 164 N/A INTRINSIC
transmembrane domain 177 196 N/A INTRINSIC
transmembrane domain 216 235 N/A INTRINSIC
transmembrane domain 242 261 N/A INTRINSIC
transmembrane domain 281 300 N/A INTRINSIC
CYCc 325 547 1.69e-63 SMART
transmembrane domain 791 813 N/A INTRINSIC
transmembrane domain 823 845 N/A INTRINSIC
transmembrane domain 858 880 N/A INTRINSIC
transmembrane domain 890 912 N/A INTRINSIC
transmembrane domain 977 996 N/A INTRINSIC
CYCc 1023 1227 1.26e-39 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120080
AA Change: L478P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000113421
Gene: ENSMUSG00000005580
AA Change: L478P

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
transmembrane domain 44 63 N/A INTRINSIC
CYCc 88 310 1.69e-63 SMART
transmembrane domain 554 576 N/A INTRINSIC
transmembrane domain 586 608 N/A INTRINSIC
transmembrane domain 621 643 N/A INTRINSIC
transmembrane domain 653 675 N/A INTRINSIC
transmembrane domain 740 759 N/A INTRINSIC
CYCc 786 990 1.26e-39 SMART
Meta Mutation Damage Score 0.198 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adenylate cyclase is a membrane bound enzyme that catalyses the formation of cyclic AMP from ATP. It is regulated by a family of G protein-coupled receptors, protein kinases, and calcium. The type 9 adenylyl cyclase is a widely distributed adenylyl cyclase, and it is stimulated by beta-adrenergic receptor activation but is insensitive to forskolin, calcium, and somatostatin. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene show an increased IgG1 response to ovalbumin challenge. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A G 6: 40,926,069 M123T probably benign Het
Amer2 A G 14: 60,378,551 D65G probably damaging Het
Btnl2 T C 17: 34,358,065 W65R probably damaging Het
Camk1g T C 1: 193,359,807 T45A possibly damaging Het
Ccdc181 T A 1: 164,280,296 S183T probably damaging Het
Cep350 T C 1: 155,863,164 H2311R probably benign Het
Copa T A 1: 172,091,233 C127S probably damaging Het
Crbn T C 6: 106,790,866 Q221R probably benign Het
Dapk2 T G 9: 66,254,611 V267G probably damaging Het
Decr1 T A 4: 15,930,972 D120V probably damaging Het
Dennd1c C T 17: 57,066,562 G637D possibly damaging Het
Disp1 T C 1: 183,087,242 K1205E probably benign Het
Dnajc13 G T 9: 104,219,898 N510K possibly damaging Het
Hnrnpu T C 1: 178,331,125 probably benign Het
Iqgap1 G A 7: 80,752,338 A393V probably benign Het
Irak2 G T 6: 113,672,760 A119S probably benign Het
Itgb2l A G 16: 96,437,389 L70P probably damaging Het
Itsn1 C A 16: 91,853,044 S202* probably null Het
Mill2 A C 7: 18,856,174 E127A probably benign Het
Msh6 T C 17: 87,985,481 Y555H probably damaging Het
Myo18b A C 5: 112,692,728 S2400A probably damaging Het
Naa25 A G 5: 121,435,072 probably null Het
Nop2 A G 6: 125,134,592 N96S probably benign Het
Olfr1263 T G 2: 90,015,021 Y30* probably null Het
Olfr156 T A 4: 43,820,544 K272N probably benign Het
Olfr30 T C 11: 58,455,227 T241A probably damaging Het
Olfr739 T A 14: 50,425,031 C171S probably damaging Het
Pde5a T A 3: 122,781,628 L356* probably null Het
Ralgapa1 A T 12: 55,709,586 N1075K probably damaging Het
Rps2 G T 17: 24,720,978 A129S probably benign Het
Serinc2 A G 4: 130,260,735 S175P probably benign Het
Socs5 A T 17: 87,134,718 Q362L probably damaging Het
Srbd1 A T 17: 86,130,215 D233E probably benign Het
Srgap3 A G 6: 112,729,658 V826A probably benign Het
Tns2 A G 15: 102,113,336 E1118G possibly damaging Het
Topaz1 T C 9: 122,749,381 I452T probably benign Het
Tuba8 A G 6: 121,222,738 D127G possibly damaging Het
Tulp4 A G 17: 6,198,708 M1V probably null Het
Urb1 A G 16: 90,797,903 L247P probably damaging Het
Usp32 A G 11: 85,025,536 W861R probably damaging Het
Vmn1r48 G A 6: 90,036,378 T155I probably benign Het
Vmn2r117 A G 17: 23,460,378 L624P probably damaging Het
Vstm5 T G 9: 15,257,298 S53A probably benign Het
Yeats2 T C 16: 20,193,645 V531A probably damaging Het
Other mutations in Adcy9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Adcy9 APN 16 4304582 missense probably benign
IGL00326:Adcy9 APN 16 4294696 missense probably benign
IGL00792:Adcy9 APN 16 4288539 missense probably damaging 1.00
IGL01610:Adcy9 APN 16 4418114 missense probably damaging 1.00
IGL02376:Adcy9 APN 16 4418680 missense probably benign 0.01
IGL02424:Adcy9 APN 16 4288597 missense probably damaging 1.00
IGL03097:Adcy9 UTSW 16 4418066 missense possibly damaging 0.94
R0043:Adcy9 UTSW 16 4289015 missense probably benign 0.12
R0085:Adcy9 UTSW 16 4288224 missense probably benign
R0105:Adcy9 UTSW 16 4288388 missense probably damaging 1.00
R0105:Adcy9 UTSW 16 4288388 missense probably damaging 1.00
R0371:Adcy9 UTSW 16 4288047 missense probably benign 0.06
R0613:Adcy9 UTSW 16 4419539 missense probably damaging 1.00
R0689:Adcy9 UTSW 16 4312804 splice site probably benign
R0744:Adcy9 UTSW 16 4419271 missense possibly damaging 0.69
R0836:Adcy9 UTSW 16 4419271 missense possibly damaging 0.69
R1223:Adcy9 UTSW 16 4298748 missense probably damaging 1.00
R1251:Adcy9 UTSW 16 4311531 missense probably damaging 0.99
R1689:Adcy9 UTSW 16 4297562 splice site probably null
R1922:Adcy9 UTSW 16 4311657 missense probably damaging 1.00
R1955:Adcy9 UTSW 16 4418659 missense possibly damaging 0.63
R1989:Adcy9 UTSW 16 4298727 missense probably damaging 1.00
R1998:Adcy9 UTSW 16 4297412 missense probably benign 0.00
R2321:Adcy9 UTSW 16 4288268 missense probably damaging 1.00
R3161:Adcy9 UTSW 16 4311588 missense probably damaging 1.00
R3162:Adcy9 UTSW 16 4311588 missense probably damaging 1.00
R3162:Adcy9 UTSW 16 4311588 missense probably damaging 1.00
R4065:Adcy9 UTSW 16 4288434 missense probably damaging 1.00
R4909:Adcy9 UTSW 16 4298754 missense probably benign 0.03
R5078:Adcy9 UTSW 16 4323907 missense probably benign 0.00
R5870:Adcy9 UTSW 16 4418368 missense probably damaging 1.00
R5968:Adcy9 UTSW 16 4298742 missense probably damaging 1.00
R5975:Adcy9 UTSW 16 4311567 missense probably damaging 0.98
R6014:Adcy9 UTSW 16 4418819 missense probably damaging 1.00
R6035:Adcy9 UTSW 16 4304513 missense probably benign
R6035:Adcy9 UTSW 16 4304513 missense probably benign
R6081:Adcy9 UTSW 16 4294681 missense probably benign
R6192:Adcy9 UTSW 16 4287954 missense probably benign
R6604:Adcy9 UTSW 16 4304407 missense probably damaging 0.98
R6739:Adcy9 UTSW 16 4418794 missense probably benign
R6829:Adcy9 UTSW 16 4307154 critical splice donor site probably null
R6986:Adcy9 UTSW 16 4311577 missense probably damaging 0.99
X0023:Adcy9 UTSW 16 4323916 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGTGGGTATATCAGGCAGTATATAGTG -3'
(R):5'- TTGACTCCCAGGACTCAGTG -3'

Sequencing Primer
(F):5'- GTGAATTTCAAGTTACCCCATAACAC -3'
(R):5'- TCCCAGGACTCAGTGTGGAG -3'
Posted On2015-01-23