Mutagenetix > Incidental Mutations

Incidental Mutation 'R3160:Itgb2l'

258127

Institutional Source

Beutler Lab

Gene Symbol

Itgb2l

Ensembl Gene

ENSMUSG00000000157

Gene Name

integrin beta 2-like

Synonyms

pactolus, 5033406G21Rik

MMRRC Submission

040611-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.131) question?

Stock #

R3160 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

96422288-96443619 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 96437389 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 70 (L70P)

Ref Sequence

ENSEMBL: ENSMUSP00000109403 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000000161] [ENSMUST00000113773] [ENSMUST00000113795] [ENSMUST00000131567]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000000161
AA Change: L70P

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000000161
Gene: ENSMUSG00000000157
AA Change: L70P

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
EGF_like	24	63	3.95e1	SMART
PSI	24	74	2.88e-4	SMART
INB	32	419	7.05e-119	SMART
VWA	126	329	1.16e0	SMART
EGF_like	553	585	4.64e1	SMART
Integrin_B_tail	594	669	1.22e-9	SMART
transmembrane domain	672	694	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000113773
AA Change: L70P

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000109403
Gene: ENSMUSG00000000157
AA Change: L70P

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
EGF_like	24	63	3.95e1	SMART
PSI	24	74	2.88e-4	SMART
INB	32	419	7.05e-119	SMART
VWA	126	329	1.16e0	SMART
EGF_like	553	585	4.64e1	SMART
Integrin_B_tail	594	669	1.22e-9	SMART
transmembrane domain	672	694	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000113795

SMART Domains

Protein: ENSMUSP00000109426
Gene: ENSMUSG00000000159

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
IG	31	125	4.74e-5	SMART
transmembrane domain	139	161	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000131567
AA Change: L70P

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000114497
Gene: ENSMUSG00000000157
AA Change: L70P

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
PSI	24	74	2.88e-4	SMART
INB	32	419	7.05e-119	SMART
VWA	126	329	1.16e0	SMART

Meta Mutation Damage Score

0.0328

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.9%
20x: 93.8%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele display normal leukocyte development and normal neutrophil recruitment to inflamed tissues. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700074P13Rik	A	G	6: 40,926,069	M123T	probably benign	Het
Adcy9	A	G	16: 4,311,588	L715P	probably damaging	Het
Amer2	A	G	14: 60,378,551	D65G	probably damaging	Het
Btnl2	T	C	17: 34,358,065	W65R	probably damaging	Het
Camk1g	T	C	1: 193,359,807	T45A	possibly damaging	Het
Ccdc181	T	A	1: 164,280,296	S183T	probably damaging	Het
Cep350	T	C	1: 155,863,164	H2311R	probably benign	Het
Copa	T	A	1: 172,091,233	C127S	probably damaging	Het
Crbn	T	C	6: 106,790,866	Q221R	probably benign	Het
Dapk2	T	G	9: 66,254,611	V267G	probably damaging	Het
Decr1	T	A	4: 15,930,972	D120V	probably damaging	Het
Dennd1c	C	T	17: 57,066,562	G637D	possibly damaging	Het
Disp1	T	C	1: 183,087,242	K1205E	probably benign	Het
Dnajc13	G	T	9: 104,219,898	N510K	possibly damaging	Het
Hnrnpu	T	C	1: 178,331,125		probably benign	Het
Iqgap1	G	A	7: 80,752,338	A393V	probably benign	Het
Irak2	G	T	6: 113,672,760	A119S	probably benign	Het
Itsn1	C	A	16: 91,853,044	S202*	probably null	Het
Mill2	A	C	7: 18,856,174	E127A	probably benign	Het
Msh6	T	C	17: 87,985,481	Y555H	probably damaging	Het
Myo18b	A	C	5: 112,692,728	S2400A	probably damaging	Het
Naa25	A	G	5: 121,435,072		probably null	Het
Nop2	A	G	6: 125,134,592	N96S	probably benign	Het
Olfr1263	T	G	2: 90,015,021	Y30*	probably null	Het
Olfr156	T	A	4: 43,820,544	K272N	probably benign	Het
Olfr30	T	C	11: 58,455,227	T241A	probably damaging	Het
Olfr739	T	A	14: 50,425,031	C171S	probably damaging	Het
Pde5a	T	A	3: 122,781,628	L356*	probably null	Het
Ralgapa1	A	T	12: 55,709,586	N1075K	probably damaging	Het
Rps2	G	T	17: 24,720,978	A129S	probably benign	Het
Serinc2	A	G	4: 130,260,735	S175P	probably benign	Het
Socs5	A	T	17: 87,134,718	Q362L	probably damaging	Het
Srbd1	A	T	17: 86,130,215	D233E	probably benign	Het
Srgap3	A	G	6: 112,729,658	V826A	probably benign	Het
Tns2	A	G	15: 102,113,336	E1118G	possibly damaging	Het
Topaz1	T	C	9: 122,749,381	I452T	probably benign	Het
Tuba8	A	G	6: 121,222,738	D127G	possibly damaging	Het
Tulp4	A	G	17: 6,198,708	M1V	probably null	Het
Urb1	A	G	16: 90,797,903	L247P	probably damaging	Het
Usp32	A	G	11: 85,025,536	W861R	probably damaging	Het
Vmn1r48	G	A	6: 90,036,378	T155I	probably benign	Het
Vmn2r117	A	G	17: 23,460,378	L624P	probably damaging	Het
Vstm5	T	G	9: 15,257,298	S53A	probably benign	Het
Yeats2	T	C	16: 20,193,645	V531A	probably damaging	Het

Other mutations in Itgb2l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00952:Itgb2l	APN	16	96426750	missense	probably damaging	0.98
IGL01482:Itgb2l	APN	16	96438748	missense	probably damaging	0.99
IGL01767:Itgb2l	APN	16	96430575	missense	probably benign	0.05
IGL02056:Itgb2l	APN	16	96427689	missense	probably damaging	0.97
IGL02072:Itgb2l	APN	16	96430608	missense	probably benign
IGL02858:Itgb2l	APN	16	96422650	missense	possibly damaging	0.96
R0011:Itgb2l	UTSW	16	96427661	splice site	probably benign
R0153:Itgb2l	UTSW	16	96437369	missense	possibly damaging	0.94
R0270:Itgb2l	UTSW	16	96422930	unclassified	probably benign
R0496:Itgb2l	UTSW	16	96434701	missense	possibly damaging	0.86
R0627:Itgb2l	UTSW	16	96422911	unclassified	probably benign
R1185:Itgb2l	UTSW	16	96429040	missense	possibly damaging	0.90
R1185:Itgb2l	UTSW	16	96429040	missense	possibly damaging	0.90
R1185:Itgb2l	UTSW	16	96429040	missense	possibly damaging	0.90
R1509:Itgb2l	UTSW	16	96426849	missense	probably benign	0.28
R1792:Itgb2l	UTSW	16	96425082	missense	probably damaging	1.00
R1912:Itgb2l	UTSW	16	96426935	missense	probably benign	0.17
R2210:Itgb2l	UTSW	16	96426221	missense	possibly damaging	0.82
R3162:Itgb2l	UTSW	16	96437389	missense	probably damaging	0.99
R3836:Itgb2l	UTSW	16	96426167	missense	probably benign
R4131:Itgb2l	UTSW	16	96437389	missense	probably damaging	0.99
R4132:Itgb2l	UTSW	16	96437389	missense	probably damaging	0.99
R4254:Itgb2l	UTSW	16	96430577	missense	probably benign	0.00
R4854:Itgb2l	UTSW	16	96426117	nonsense	probably null
R4893:Itgb2l	UTSW	16	96427821	missense	probably benign	0.12
R4931:Itgb2l	UTSW	16	96437449	missense	probably damaging	1.00
R5039:Itgb2l	UTSW	16	96425005	missense	possibly damaging	0.69
R5055:Itgb2l	UTSW	16	96427803	missense	probably damaging	1.00
R5960:Itgb2l	UTSW	16	96426259	missense	probably benign	0.00
R6412:Itgb2l	UTSW	16	96427729	missense	probably benign	0.04
R6966:Itgb2l	UTSW	16	96430643	missense	probably benign	0.02
X0018:Itgb2l	UTSW	16	96435676	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- GGTCGAGCTCCTGTAAATGC -3'
(R):5'- GGAGATCAAGGCTGTCTCTAAG -3'

Sequencing Primer
(F):5'- GTCGAGCTCCTGTAAATGCTATGTAC -3'
(R):5'- ATCAAGGCTGTCTCTAAGGCCAG -3'

Posted On

2015-01-23