Incidental Mutation 'R3160:Vmn2r117'
ID258129
Institutional Source Beutler Lab
Gene Symbol Vmn2r117
Ensembl Gene ENSMUSG00000091407
Gene Namevomeronasal 2, receptor 117
SynonymsEG619788
MMRRC Submission 040611-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.361) question?
Stock #R3160 (G1)
Quality Score148
Status Not validated
Chromosome17
Chromosomal Location23459675-23479597 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23460378 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 624 (L624P)
Ref Sequence ENSEMBL: ENSMUSP00000126885 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171996]
Predicted Effect probably damaging
Transcript: ENSMUST00000171996
AA Change: L624P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126885
Gene: ENSMUSG00000091407
AA Change: L624P

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 471 2.6e-28 PFAM
Pfam:NCD3G 512 565 5e-20 PFAM
Pfam:7tm_3 595 833 8.2e-54 PFAM
Meta Mutation Damage Score 0.0336 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A G 6: 40,926,069 M123T probably benign Het
Adcy9 A G 16: 4,311,588 L715P probably damaging Het
Amer2 A G 14: 60,378,551 D65G probably damaging Het
Btnl2 T C 17: 34,358,065 W65R probably damaging Het
Camk1g T C 1: 193,359,807 T45A possibly damaging Het
Ccdc181 T A 1: 164,280,296 S183T probably damaging Het
Cep350 T C 1: 155,863,164 H2311R probably benign Het
Copa T A 1: 172,091,233 C127S probably damaging Het
Crbn T C 6: 106,790,866 Q221R probably benign Het
Dapk2 T G 9: 66,254,611 V267G probably damaging Het
Decr1 T A 4: 15,930,972 D120V probably damaging Het
Dennd1c C T 17: 57,066,562 G637D possibly damaging Het
Disp1 T C 1: 183,087,242 K1205E probably benign Het
Dnajc13 G T 9: 104,219,898 N510K possibly damaging Het
Hnrnpu T C 1: 178,331,125 probably benign Het
Iqgap1 G A 7: 80,752,338 A393V probably benign Het
Irak2 G T 6: 113,672,760 A119S probably benign Het
Itgb2l A G 16: 96,437,389 L70P probably damaging Het
Itsn1 C A 16: 91,853,044 S202* probably null Het
Mill2 A C 7: 18,856,174 E127A probably benign Het
Msh6 T C 17: 87,985,481 Y555H probably damaging Het
Myo18b A C 5: 112,692,728 S2400A probably damaging Het
Naa25 A G 5: 121,435,072 probably null Het
Nop2 A G 6: 125,134,592 N96S probably benign Het
Olfr1263 T G 2: 90,015,021 Y30* probably null Het
Olfr156 T A 4: 43,820,544 K272N probably benign Het
Olfr30 T C 11: 58,455,227 T241A probably damaging Het
Olfr739 T A 14: 50,425,031 C171S probably damaging Het
Pde5a T A 3: 122,781,628 L356* probably null Het
Ralgapa1 A T 12: 55,709,586 N1075K probably damaging Het
Rps2 G T 17: 24,720,978 A129S probably benign Het
Serinc2 A G 4: 130,260,735 S175P probably benign Het
Socs5 A T 17: 87,134,718 Q362L probably damaging Het
Srbd1 A T 17: 86,130,215 D233E probably benign Het
Srgap3 A G 6: 112,729,658 V826A probably benign Het
Tns2 A G 15: 102,113,336 E1118G possibly damaging Het
Topaz1 T C 9: 122,749,381 I452T probably benign Het
Tuba8 A G 6: 121,222,738 D127G possibly damaging Het
Tulp4 A G 17: 6,198,708 M1V probably null Het
Urb1 A G 16: 90,797,903 L247P probably damaging Het
Usp32 A G 11: 85,025,536 W861R probably damaging Het
Vmn1r48 G A 6: 90,036,378 T155I probably benign Het
Vstm5 T G 9: 15,257,298 S53A probably benign Het
Yeats2 T C 16: 20,193,645 V531A probably damaging Het
Other mutations in Vmn2r117
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Vmn2r117 APN 17 23477840 missense probably damaging 1.00
IGL00990:Vmn2r117 APN 17 23475429 missense probably damaging 1.00
IGL00990:Vmn2r117 APN 17 23479546 missense probably benign
IGL01078:Vmn2r117 APN 17 23477804 missense probably damaging 1.00
IGL01139:Vmn2r117 APN 17 23477804 missense probably damaging 1.00
IGL01374:Vmn2r117 APN 17 23478382 missense possibly damaging 0.46
IGL01779:Vmn2r117 APN 17 23477241 missense probably benign 0.00
IGL02283:Vmn2r117 APN 17 23475382 missense probably damaging 0.99
IGL02527:Vmn2r117 APN 17 23477225 missense possibly damaging 0.65
IGL02612:Vmn2r117 APN 17 23459784 missense possibly damaging 0.91
IGL02887:Vmn2r117 APN 17 23475578 splice site probably benign
IGL03167:Vmn2r117 APN 17 23477707 missense probably damaging 1.00
R0315:Vmn2r117 UTSW 17 23460165 missense probably benign 0.11
R0610:Vmn2r117 UTSW 17 23475514 missense probably benign 0.00
R0747:Vmn2r117 UTSW 17 23475503 nonsense probably null
R1411:Vmn2r117 UTSW 17 23460553 missense probably damaging 1.00
R1471:Vmn2r117 UTSW 17 23478473 missense probably benign 0.00
R1853:Vmn2r117 UTSW 17 23477455 missense probably damaging 0.99
R1925:Vmn2r117 UTSW 17 23478389 missense probably benign 0.00
R1940:Vmn2r117 UTSW 17 23477480 missense probably damaging 1.00
R2005:Vmn2r117 UTSW 17 23477644 missense probably damaging 1.00
R2082:Vmn2r117 UTSW 17 23460256 missense possibly damaging 0.55
R2698:Vmn2r117 UTSW 17 23459911 missense probably damaging 0.98
R2972:Vmn2r117 UTSW 17 23459856 missense probably damaging 1.00
R2973:Vmn2r117 UTSW 17 23459856 missense probably damaging 1.00
R2974:Vmn2r117 UTSW 17 23459856 missense probably damaging 1.00
R3161:Vmn2r117 UTSW 17 23460378 missense probably damaging 1.00
R3162:Vmn2r117 UTSW 17 23460378 missense probably damaging 1.00
R3847:Vmn2r117 UTSW 17 23460415 missense probably damaging 0.97
R3848:Vmn2r117 UTSW 17 23460415 missense probably damaging 0.97
R4082:Vmn2r117 UTSW 17 23460106 missense probably benign 0.00
R4320:Vmn2r117 UTSW 17 23479513 frame shift probably null
R4560:Vmn2r117 UTSW 17 23459877 missense probably damaging 1.00
R4658:Vmn2r117 UTSW 17 23478416 missense probably benign 0.01
R4881:Vmn2r117 UTSW 17 23477885 missense probably damaging 1.00
R4908:Vmn2r117 UTSW 17 23459838 missense probably damaging 1.00
R4910:Vmn2r117 UTSW 17 23479513 frame shift probably null
R5078:Vmn2r117 UTSW 17 23460148 missense probably damaging 1.00
R5327:Vmn2r117 UTSW 17 23477874 nonsense probably null
R5774:Vmn2r117 UTSW 17 23477202 missense probably damaging 0.98
R6014:Vmn2r117 UTSW 17 23479561 missense probably damaging 0.97
R6390:Vmn2r117 UTSW 17 23460114 missense possibly damaging 0.95
R6520:Vmn2r117 UTSW 17 23460219 missense probably damaging 0.99
R6674:Vmn2r117 UTSW 17 23460049 nonsense probably null
R6736:Vmn2r117 UTSW 17 23478308 missense probably damaging 0.99
R6909:Vmn2r117 UTSW 17 23479505 missense possibly damaging 0.67
R6913:Vmn2r117 UTSW 17 23479563 missense probably damaging 0.99
V5622:Vmn2r117 UTSW 17 23477840 missense probably damaging 1.00
V5622:Vmn2r117 UTSW 17 23479505 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- ACTTCATCATTCTTTGGGAGGC -3'
(R):5'- CAGTGTCTGGAGGACCAATATGC -3'

Sequencing Primer
(F):5'- AGGCTGTGATTTTGAATGCCAGAAC -3'
(R):5'- TGTCTGGAGGACCAATATGCTAACAC -3'
Posted On2015-01-23