Incidental Mutation 'R3160:Rps2'
ID 258131
Institutional Source Beutler Lab
Gene Symbol Rps2
Ensembl Gene ENSMUSG00000044533
Gene Name ribosomal protein S2
Synonyms Rps2, Llrep3
MMRRC Submission 040611-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.233) question?
Stock # R3160 (G1)
Quality Score 163
Status Not validated
Chromosome 17
Chromosomal Location 24939037-24940901 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 24939952 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Serine at position 129 (A129S)
Ref Sequence ENSEMBL: ENSMUSP00000120715 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008626] [ENSMUST00000045602] [ENSMUST00000054289] [ENSMUST00000146867] [ENSMUST00000152407] [ENSMUST00000170715] [ENSMUST00000135708]
AlphaFold P25444
Predicted Effect probably benign
Transcript: ENSMUST00000008626
SMART Domains Protein: ENSMUSP00000008626
Gene: ENSMUSG00000008482

DomainStartEndE-ValueType
RING 20 57 1.76e-5 SMART
Pfam:zf-TRAF 102 158 7.5e-9 PFAM
low complexity region 176 193 N/A INTRINSIC
low complexity region 203 216 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000045602
SMART Domains Protein: ENSMUSP00000043543
Gene: ENSMUSG00000040048

DomainStartEndE-ValueType
low complexity region 11 25 N/A INTRINSIC
Pfam:NDUFB10 42 168 2.1e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000054289
AA Change: A129S

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000092502
Gene: ENSMUSG00000044533
AA Change: A129S

DomainStartEndE-ValueType
low complexity region 6 53 N/A INTRINSIC
Pfam:Ribosomal_S5 102 166 5.7e-34 PFAM
Pfam:Ribosomal_S5_C 185 256 2.4e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104521
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122809
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129451
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129580
Predicted Effect probably benign
Transcript: ENSMUST00000146867
AA Change: A129S

PolyPhen 2 Score 0.160 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000120715
Gene: ENSMUSG00000044533
AA Change: A129S

DomainStartEndE-ValueType
low complexity region 6 53 N/A INTRINSIC
Pfam:Ribosomal_S5 102 166 1.7e-35 PFAM
Pfam:Ribosomal_S5_C 185 256 8.3e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152407
AA Change: A129S

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000114529
Gene: ENSMUSG00000044533
AA Change: A129S

DomainStartEndE-ValueType
low complexity region 6 53 N/A INTRINSIC
Pfam:Ribosomal_S5 101 167 9.2e-32 PFAM
Pfam:Ribosomal_S5_C 184 257 1.2e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170715
AA Change: A129S

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000131474
Gene: ENSMUSG00000044533
AA Change: A129S

DomainStartEndE-ValueType
low complexity region 6 53 N/A INTRINSIC
Pfam:Ribosomal_S5 101 167 1.1e-31 PFAM
Pfam:Ribosomal_S5_C 184 257 1.3e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141324
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144285
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129984
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132803
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147648
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158630
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161706
Predicted Effect probably benign
Transcript: ENSMUST00000135708
SMART Domains Protein: ENSMUSP00000120091
Gene: ENSMUSG00000040048

DomainStartEndE-ValueType
low complexity region 11 25 N/A INTRINSIC
Pfam:NDUFB10 54 149 7.1e-40 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S5P family of ribosomal proteins. It is located in the cytoplasm. This gene shares sequence similarity with mouse LLRep3. It is co-transcribed with the small nucleolar RNA gene U64, which is located in its third intron. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy9 A G 16: 4,129,452 (GRCm39) L715P probably damaging Het
Amer2 A G 14: 60,616,000 (GRCm39) D65G probably damaging Het
Btnl2 T C 17: 34,577,039 (GRCm39) W65R probably damaging Het
Camk1g T C 1: 193,042,115 (GRCm39) T45A possibly damaging Het
Ccdc181 T A 1: 164,107,865 (GRCm39) S183T probably damaging Het
Cep350 T C 1: 155,738,910 (GRCm39) H2311R probably benign Het
Copa T A 1: 171,918,800 (GRCm39) C127S probably damaging Het
Crbn T C 6: 106,767,827 (GRCm39) Q221R probably benign Het
Dapk2 T G 9: 66,161,893 (GRCm39) V267G probably damaging Het
Decr1 T A 4: 15,930,972 (GRCm39) D120V probably damaging Het
Dennd1c C T 17: 57,373,562 (GRCm39) G637D possibly damaging Het
Disp1 T C 1: 182,868,806 (GRCm39) K1205E probably benign Het
Dnajc13 G T 9: 104,097,097 (GRCm39) N510K possibly damaging Het
Hnrnpu T C 1: 178,158,690 (GRCm39) probably benign Het
Iqgap1 G A 7: 80,402,086 (GRCm39) A393V probably benign Het
Irak2 G T 6: 113,649,721 (GRCm39) A119S probably benign Het
Itgb2l A G 16: 96,238,589 (GRCm39) L70P probably damaging Het
Itsn1 C A 16: 91,649,932 (GRCm39) S202* probably null Het
Mill2 A C 7: 18,590,099 (GRCm39) E127A probably benign Het
Msh6 T C 17: 88,292,909 (GRCm39) Y555H probably damaging Het
Myo18b A C 5: 112,840,594 (GRCm39) S2400A probably damaging Het
Naa25 A G 5: 121,573,135 (GRCm39) probably null Het
Nop2 A G 6: 125,111,555 (GRCm39) N96S probably benign Het
Or11g24 T A 14: 50,662,488 (GRCm39) C171S probably damaging Het
Or13c7b T A 4: 43,820,544 (GRCm39) K272N probably benign Het
Or2z2 T C 11: 58,346,053 (GRCm39) T241A probably damaging Het
Or4c52 T G 2: 89,845,365 (GRCm39) Y30* probably null Het
Pde5a T A 3: 122,575,277 (GRCm39) L356* probably null Het
Prss59 A G 6: 40,903,003 (GRCm39) M123T probably benign Het
Ralgapa1 A T 12: 55,756,371 (GRCm39) N1075K probably damaging Het
Serinc2 A G 4: 130,154,528 (GRCm39) S175P probably benign Het
Socs5 A T 17: 87,442,146 (GRCm39) Q362L probably damaging Het
Srbd1 A T 17: 86,437,643 (GRCm39) D233E probably benign Het
Srgap3 A G 6: 112,706,619 (GRCm39) V826A probably benign Het
Tns2 A G 15: 102,021,771 (GRCm39) E1118G possibly damaging Het
Topaz1 T C 9: 122,578,446 (GRCm39) I452T probably benign Het
Tuba8 A G 6: 121,199,697 (GRCm39) D127G possibly damaging Het
Tulp4 A G 17: 6,248,983 (GRCm39) M1V probably null Het
Urb1 A G 16: 90,594,791 (GRCm39) L247P probably damaging Het
Usp32 A G 11: 84,916,362 (GRCm39) W861R probably damaging Het
Vmn1r48 G A 6: 90,013,360 (GRCm39) T155I probably benign Het
Vmn2r117 A G 17: 23,679,352 (GRCm39) L624P probably damaging Het
Vstm5 T G 9: 15,168,594 (GRCm39) S53A probably benign Het
Yeats2 T C 16: 20,012,395 (GRCm39) V531A probably damaging Het
Other mutations in Rps2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02836:Rps2 APN 17 24,939,650 (GRCm39) missense probably damaging 1.00
IGL02981:Rps2 APN 17 24,940,698 (GRCm39) missense probably benign 0.00
IGL03123:Rps2 APN 17 24,939,263 (GRCm39) unclassified probably benign
R2504:Rps2 UTSW 17 24,939,353 (GRCm39) unclassified probably benign
R3161:Rps2 UTSW 17 24,939,952 (GRCm39) missense probably benign 0.16
R3162:Rps2 UTSW 17 24,939,952 (GRCm39) missense probably benign 0.16
R5877:Rps2 UTSW 17 24,939,890 (GRCm39) intron probably benign
R7247:Rps2 UTSW 17 24,939,554 (GRCm39) missense possibly damaging 0.86
R8135:Rps2 UTSW 17 24,939,409 (GRCm39) missense probably benign 0.27
R8351:Rps2 UTSW 17 24,939,334 (GRCm39) unclassified probably benign
R8862:Rps2 UTSW 17 24,940,662 (GRCm39) missense probably benign 0.01
R8947:Rps2 UTSW 17 24,940,227 (GRCm39) missense probably benign 0.00
R9536:Rps2 UTSW 17 24,940,851 (GRCm39) missense unknown
R9762:Rps2 UTSW 17 24,940,810 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- CGTGTGACTTTCGTACGGAGAG -3'
(R):5'- AGACAATGCCAGTGCCTCTG -3'

Sequencing Primer
(F):5'- AGAGAGAGAAAACGAGTTCCTTC -3'
(R):5'- GGATGAGACGCACCAGCAC -3'
Posted On 2015-01-23