Incidental Mutation 'R3161:Daam1'
ID258179
Institutional Source Beutler Lab
Gene Symbol Daam1
Ensembl Gene ENSMUSG00000034574
Gene Namedishevelled associated activator of morphogenesis 1
Synonyms1700066F09Rik, 2310028E21Rik
MMRRC Submission 040612-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3161 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location71831078-71992333 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 71947098 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 425 (T425K)
Ref Sequence ENSEMBL: ENSMUSP00000152564 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085299] [ENSMUST00000221317] [ENSMUST00000223272]
Predicted Effect unknown
Transcript: ENSMUST00000085299
AA Change: T425K
SMART Domains Protein: ENSMUSP00000082406
Gene: ENSMUSG00000034574
AA Change: T425K

DomainStartEndE-ValueType
Drf_GBD 45 232 4.99e-67 SMART
Drf_FH3 235 433 1.92e-77 SMART
SCOP:d1eq1a_ 442 522 4e-3 SMART
Blast:Drf_FH3 459 519 1e-9 BLAST
SCOP:d1jvr__ 532 565 5e-3 SMART
FH2 600 1060 9.99e-110 SMART
Predicted Effect unknown
Transcript: ENSMUST00000221317
AA Change: T425K
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221971
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222327
Predicted Effect unknown
Transcript: ENSMUST00000223272
AA Change: T425K
Meta Mutation Damage Score 0.212 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cell motility, adhesion, cytokinesis, and other functions of the cell cortex are mediated by reorganization of the actin cytoskeleton and several formin homology (FH) proteins have been associated with these processes. The protein encoded by this gene contains two FH domains and belongs to a novel FH protein subfamily implicated in cell polarity. A key regulator of cytoskeletal architecture, the small GTPase Rho, is activated during development by Wnt/Fz signaling to control cell polarity and movement. The protein encoded by this gene is thought to function as a scaffolding protein for the Wnt-induced assembly of a disheveled (Dvl)-Rho complex. This protein also promotes the nucleation and elongation of new actin filaments and regulates cell growth through the stabilization of microtubules. Alternative splicing results in multiple transcript variants encoding distinct proteins. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygotes for a gene trap allele show reduced fetal size, partial embryonic and neonatal lethality, altered cytoskeletal structure, cardiac defects including ventricular noncompaction, double outlet right ventricles and ventricular septal defects, and impaired cell adhesion and wound healing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T C 5: 63,896,490 probably benign Het
1700066M21Rik T A 1: 57,383,075 N203K probably benign Het
1700125H20Rik A G 11: 85,173,284 S84G probably damaging Het
Adcy9 A G 16: 4,311,588 L715P probably damaging Het
Adgrl2 G A 3: 148,817,551 L1354F probably damaging Het
Amer2 A G 14: 60,378,551 D65G probably damaging Het
Aox2 G T 1: 58,304,438 V427L possibly damaging Het
Atad2b C A 12: 4,939,689 N133K possibly damaging Het
Bptf A T 11: 107,074,476 D1182E probably damaging Het
Camk1g T C 1: 193,359,807 T45A possibly damaging Het
Caps2 C A 10: 112,182,486 Y180* probably null Het
Cfap54 T A 10: 93,045,278 K349N probably damaging Het
Ciz1 A G 2: 32,370,063 D207G probably benign Het
Copa T A 1: 172,091,233 C127S probably damaging Het
Crabp2 A T 3: 87,952,177 K45* probably null Het
Dapk2 T G 9: 66,254,611 V267G probably damaging Het
Disp1 T C 1: 183,087,242 K1205E probably benign Het
Dlg4 G C 11: 70,017,225 R4T probably damaging Het
Fbf1 A G 11: 116,148,220 I743T probably damaging Het
Fen1 A G 19: 10,200,291 L263P probably damaging Het
G6pc2 A G 2: 69,220,112 N27S probably damaging Het
Garnl3 A T 2: 33,034,711 N246K probably damaging Het
Gm7337 A C 5: 87,851,557 noncoding transcript Het
Gpr152 A G 19: 4,142,714 T85A probably benign Het
Hnrnpu T C 1: 178,331,125 probably benign Het
Ighv1-81 C G 12: 115,920,329 E101Q probably benign Het
Ipo9 T C 1: 135,409,476 T174A probably benign Het
Myo9a C T 9: 59,832,315 probably benign Het
Nup155 G T 15: 8,148,383 R1083S possibly damaging Het
Olfr1351 C A 10: 79,017,604 T94N probably benign Het
Olfr213 C T 6: 116,540,846 A131V probably damaging Het
Olfr262 T C 19: 12,241,496 H55R probably benign Het
Olfr739 T A 14: 50,425,031 C171S probably damaging Het
Phyh T A 2: 4,937,671 probably benign Het
Pkp4 G T 2: 59,308,105 R233M probably damaging Het
Plcb1 A T 2: 135,335,482 Q578L probably benign Het
Ppil3 A T 1: 58,434,414 N92K probably benign Het
Prokr1 C T 6: 87,588,431 R144H probably damaging Het
Psap T C 10: 60,277,753 L4P possibly damaging Het
Rai14 T C 15: 10,633,164 T47A possibly damaging Het
Rps2 G T 17: 24,720,978 A129S probably benign Het
Sult2a4 T C 7: 13,989,471 T40A probably benign Het
Tacr2 A G 10: 62,265,245 D378G probably benign Het
Topaz1 T C 9: 122,749,381 I452T probably benign Het
Ttn A G 2: 76,833,237 probably benign Het
Vmn2r115 T A 17: 23,357,024 M532K possibly damaging Het
Vmn2r117 A G 17: 23,460,378 L624P probably damaging Het
Vstm5 T G 9: 15,257,298 S53A probably benign Het
Wipf1 C T 2: 73,434,949 E437K probably damaging Het
Wls G T 3: 159,897,436 C162F probably damaging Het
Yeats2 T C 16: 20,193,645 V531A probably damaging Het
Zfp868 A G 8: 69,612,085 S200P probably benign Het
Other mutations in Daam1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Daam1 APN 12 71942219 missense unknown
IGL00323:Daam1 APN 12 71958743 splice site probably benign
IGL00885:Daam1 APN 12 71944091 missense unknown
IGL01768:Daam1 APN 12 71989885 missense probably benign 0.39
IGL02189:Daam1 APN 12 71946285 missense unknown
IGL02237:Daam1 APN 12 71982721 missense probably benign 0.01
IGL02486:Daam1 APN 12 71947145 splice site probably benign
IGL02561:Daam1 APN 12 71946516 missense unknown
IGL02699:Daam1 APN 12 71988943 missense probably damaging 1.00
IGL02977:Daam1 APN 12 71944172 missense unknown
R0390:Daam1 UTSW 12 71975304 splice site probably benign
R0492:Daam1 UTSW 12 71944380 missense unknown
R0780:Daam1 UTSW 12 71947050 missense unknown
R0973:Daam1 UTSW 12 71915784 missense unknown
R0973:Daam1 UTSW 12 71915784 missense unknown
R0974:Daam1 UTSW 12 71915784 missense unknown
R1264:Daam1 UTSW 12 71975311 splice site probably benign
R1462:Daam1 UTSW 12 71944142 missense unknown
R1462:Daam1 UTSW 12 71944142 missense unknown
R1510:Daam1 UTSW 12 71977726 missense probably damaging 1.00
R1535:Daam1 UTSW 12 71951918 missense unknown
R1688:Daam1 UTSW 12 71947046 missense unknown
R1713:Daam1 UTSW 12 71895882 missense unknown
R1957:Daam1 UTSW 12 71982755 critical splice donor site probably null
R1974:Daam1 UTSW 12 71988929 missense probably damaging 0.99
R2217:Daam1 UTSW 12 71989827 missense probably damaging 1.00
R2507:Daam1 UTSW 12 71975223 missense probably damaging 1.00
R2508:Daam1 UTSW 12 71975223 missense probably damaging 1.00
R3748:Daam1 UTSW 12 71971166 missense probably damaging 1.00
R3749:Daam1 UTSW 12 71971166 missense probably damaging 1.00
R4635:Daam1 UTSW 12 71958744 splice site probably null
R4862:Daam1 UTSW 12 71942207 missense unknown
R5033:Daam1 UTSW 12 71946520 missense unknown
R5180:Daam1 UTSW 12 71947125 missense unknown
R5202:Daam1 UTSW 12 71944274 missense unknown
R5254:Daam1 UTSW 12 71946576 missense unknown
R5358:Daam1 UTSW 12 71952459 nonsense probably null
R5413:Daam1 UTSW 12 71946292 missense unknown
R5733:Daam1 UTSW 12 71945498 missense unknown
R5752:Daam1 UTSW 12 71946546 missense unknown
R5891:Daam1 UTSW 12 71944149 missense unknown
R6111:Daam1 UTSW 12 71942264 missense unknown
R6182:Daam1 UTSW 12 71959887 nonsense probably null
R6251:Daam1 UTSW 12 71988949 missense probably damaging 1.00
R6252:Daam1 UTSW 12 71988949 missense probably damaging 1.00
R6291:Daam1 UTSW 12 71946251 missense unknown
R6379:Daam1 UTSW 12 71951938 missense unknown
R6776:Daam1 UTSW 12 71989808 missense possibly damaging 0.96
R7167:Daam1 UTSW 12 71988904 missense probably damaging 0.99
R7223:Daam1 UTSW 12 71988943 missense probably damaging 1.00
X0019:Daam1 UTSW 12 71985692 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTATTGACAGCGACTCATC -3'
(R):5'- TCTCTGGGCACACAAACAG -3'

Sequencing Primer
(F):5'- GACAGCGACTCATCCTAGTTTAC -3'
(R):5'- CAGTGTACTGCAGAGTCCTTG -3'
Posted On2015-01-23