Incidental Mutation 'R3276:Sema4c'
ID258195
Institutional Source Beutler Lab
Gene Symbol Sema4c
Ensembl Gene ENSMUSG00000026121
Gene Namesema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4C
SynonymsSemaf, Semacl1, M-Sema F, Semacl1, Semai
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3276 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location36548639-36558349 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 36549879 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 722 (R722H)
Ref Sequence ENSEMBL: ENSMUSP00000141527 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001172] [ENSMUST00000114991] [ENSMUST00000191642] [ENSMUST00000191677] [ENSMUST00000193382] [ENSMUST00000194894] [ENSMUST00000195620] [ENSMUST00000207843]
Predicted Effect probably benign
Transcript: ENSMUST00000001172
SMART Domains Protein: ENSMUSP00000001172
Gene: ENSMUSG00000079610

DomainStartEndE-ValueType
ANK 30 59 8.77e2 SMART
ANK 63 92 1.08e-5 SMART
ANK 96 127 1.27e-2 SMART
ANK 129 158 5.62e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000114990
AA Change: R722H

PolyPhen 2 Score 0.646 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000110641
Gene: ENSMUSG00000026121
AA Change: R722H

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 53 481 2.54e-183 SMART
PSI 499 552 4.52e-11 SMART
IG 563 647 1.77e-4 SMART
transmembrane domain 665 687 N/A INTRINSIC
low complexity region 754 774 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114991
AA Change: R722H

PolyPhen 2 Score 0.646 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000110643
Gene: ENSMUSG00000026121
AA Change: R722H

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 53 481 2.54e-183 SMART
PSI 499 552 4.52e-11 SMART
IG 563 647 1.77e-4 SMART
transmembrane domain 665 687 N/A INTRINSIC
low complexity region 754 774 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000191642
AA Change: R722H

PolyPhen 2 Score 0.646 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000142284
Gene: ENSMUSG00000026121
AA Change: R722H

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 53 481 2.54e-183 SMART
PSI 499 552 4.52e-11 SMART
IG 563 647 1.77e-4 SMART
transmembrane domain 665 687 N/A INTRINSIC
low complexity region 754 774 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000191677
AA Change: R722H

PolyPhen 2 Score 0.646 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000141263
Gene: ENSMUSG00000026121
AA Change: R722H

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 53 481 2.54e-183 SMART
PSI 499 552 4.52e-11 SMART
IG 563 647 1.77e-4 SMART
transmembrane domain 665 687 N/A INTRINSIC
low complexity region 754 774 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191785
Predicted Effect probably benign
Transcript: ENSMUST00000193382
Predicted Effect probably benign
Transcript: ENSMUST00000194894
SMART Domains Protein: ENSMUSP00000141712
Gene: ENSMUSG00000079610

DomainStartEndE-ValueType
ANK 30 59 5.6e0 SMART
ANK 63 92 7.1e-8 SMART
ANK 96 127 8.2e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195160
Predicted Effect possibly damaging
Transcript: ENSMUST00000195620
AA Change: R722H

PolyPhen 2 Score 0.646 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000141527
Gene: ENSMUSG00000026121
AA Change: R722H

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 53 481 2.54e-183 SMART
PSI 499 552 4.52e-11 SMART
IG 563 647 1.77e-4 SMART
transmembrane domain 665 687 N/A INTRINSIC
low complexity region 754 774 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207843
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208269
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208690
Meta Mutation Damage Score 0.0604 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: This gene encodes a member of the semaphorin family of proteins that have diverse functions in neuronal development, heart morphogenesis, vascular growth, tumor progression and immune cell regulation. Lack of the encoded protein in some mice causes exencephaly resulting in neonatal lethality. Mice that bypass exencephaly show no obvious behavioral defects but display distinct pigmentation defects. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a targeted mutation exhibit exencephaly, neonatal lethality, and abnormal cerebellum morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 C T 8: 86,506,866 R1269H probably damaging Het
Ace A G 11: 105,976,702 E164G probably null Het
Als2 A T 1: 59,170,008 V1464E possibly damaging Het
Atox1 A G 11: 55,450,553 L52P possibly damaging Het
Btnl10 A G 11: 58,922,390 K282E probably benign Het
Cdkn3 T C 14: 46,771,477 probably benign Het
Col16a1 A G 4: 130,057,999 K72E probably damaging Het
Col6a5 G A 9: 105,911,107 R1565* probably null Het
Col6a6 T C 9: 105,786,230 H36R probably benign Het
Cyp4b1 T C 4: 115,625,850 N415D possibly damaging Het
Dennd4a G T 9: 64,888,993 R767L probably damaging Het
Dhcr24 T C 4: 106,561,239 F25L probably benign Het
Dhrs3 A G 4: 144,923,940 T219A probably benign Het
Dhx58 A G 11: 100,696,979 F584S probably damaging Het
Dmbt1 A G 7: 131,088,071 T715A probably benign Het
Eogt T A 6: 97,131,394 I229F probably benign Het
Ern2 T C 7: 122,180,964 T164A possibly damaging Het
Fam133b A T 5: 3,558,522 N84I probably damaging Het
Fbxl21 T A 13: 56,537,122 Y346* probably null Het
Fcgbp C A 7: 28,091,661 H782Q probably damaging Het
Gm11492 T C 11: 87,567,244 V148A possibly damaging Het
Gm5592 A G 7: 41,288,380 E362G probably benign Het
Golga3 T C 5: 110,201,998 probably benign Het
Gpatch2l A G 12: 86,244,315 T91A possibly damaging Het
Hsp90aa1 T A 12: 110,695,680 M1L possibly damaging Het
Hsp90aa1 C A 12: 110,695,681 probably null Het
Itgad C A 7: 128,190,981 H651N possibly damaging Het
Itgav A G 2: 83,776,542 D409G probably damaging Het
Kcnt2 A G 1: 140,609,639 N1119S probably benign Het
Klhl32 T C 4: 24,682,063 I207V probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lhfpl5 T C 17: 28,579,946 I143T possibly damaging Het
Lrrk1 T C 7: 66,305,521 K431E possibly damaging Het
Mag C T 7: 30,901,648 probably null Het
Maml3 A T 3: 51,856,930 N204K possibly damaging Het
Mrpl19 T C 6: 81,964,066 S115G probably damaging Het
Mthfd1l G C 10: 4,148,025 G954A probably damaging Het
Mut A G 17: 40,958,872 probably null Het
Myo19 A G 11: 84,892,175 I172V probably benign Het
Naca T C 10: 128,040,661 probably benign Het
Nfatc2 T C 2: 168,506,994 N638D possibly damaging Het
Nsun6 A G 2: 15,009,404 probably benign Het
Olfr1412 A G 1: 92,588,813 N161S probably benign Het
Olfr584 C A 7: 103,085,750 D72E probably damaging Het
Olfr913 T A 9: 38,594,643 C141S probably damaging Het
Padi6 A G 4: 140,735,389 L307P probably damaging Het
Pafah1b1 G A 11: 74,690,232 S57F probably damaging Het
Prcd A G 11: 116,659,811 E103G possibly damaging Het
Prkx A T X: 77,771,275 F260I probably damaging Het
Rad54l2 A G 9: 106,753,943 probably null Het
Ranbp1 T C 16: 18,247,429 probably benign Het
Rb1cc1 T A 1: 6,249,366 M1003K probably benign Het
Scap A T 9: 110,374,025 M256L probably benign Het
Sgk1 C T 10: 21,996,601 R171W probably damaging Het
Spata7 A G 12: 98,637,598 N75D possibly damaging Het
Tmem120b T A 5: 123,114,104 I146N probably damaging Het
Ttc23l A G 15: 10,547,232 F99L possibly damaging Het
Ube3a T A 7: 59,276,519 C348* probably null Het
Ubr4 T A 4: 139,421,855 D1777E probably benign Het
Unc79 C A 12: 103,113,217 D1880E probably damaging Het
Usp36 C T 11: 118,276,759 probably null Het
Zswim9 T C 7: 13,277,270 T51A possibly damaging Het
Other mutations in Sema4c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Sema4c APN 1 36553920 critical splice donor site probably benign 0.00
IGL01824:Sema4c APN 1 36553029 missense possibly damaging 0.76
IGL02236:Sema4c APN 1 36553085 missense probably damaging 1.00
IGL02262:Sema4c APN 1 36550341 missense probably damaging 1.00
IGL02282:Sema4c APN 1 36550203 unclassified probably null
IGL02476:Sema4c APN 1 36555950 missense probably damaging 0.98
IGL02900:Sema4c APN 1 36550745 nonsense probably null
swirl UTSW 1 36550311 missense probably damaging 1.00
IGL02837:Sema4c UTSW 1 36552884 missense probably damaging 1.00
R0427:Sema4c UTSW 1 36553811 nonsense probably null
R0497:Sema4c UTSW 1 36549608 missense probably benign 0.04
R1066:Sema4c UTSW 1 36550200 missense possibly damaging 0.95
R1099:Sema4c UTSW 1 36552110 missense probably damaging 1.00
R1146:Sema4c UTSW 1 36550565 missense probably benign 0.04
R1146:Sema4c UTSW 1 36550565 missense probably benign 0.04
R1639:Sema4c UTSW 1 36553534 missense probably benign 0.00
R1644:Sema4c UTSW 1 36550804 missense probably damaging 1.00
R3176:Sema4c UTSW 1 36549879 missense possibly damaging 0.65
R3177:Sema4c UTSW 1 36549879 missense possibly damaging 0.65
R3277:Sema4c UTSW 1 36549879 missense possibly damaging 0.65
R3551:Sema4c UTSW 1 36553723 missense probably benign 0.02
R4452:Sema4c UTSW 1 36553756 missense probably benign 0.31
R4883:Sema4c UTSW 1 36552016 missense probably damaging 0.98
R4895:Sema4c UTSW 1 36553570 splice site probably null
R4913:Sema4c UTSW 1 36550185 missense probably benign 0.11
R4944:Sema4c UTSW 1 36550311 missense probably damaging 1.00
R5062:Sema4c UTSW 1 36552978 critical splice donor site probably null
R5077:Sema4c UTSW 1 36551731 missense probably benign 0.20
R5109:Sema4c UTSW 1 36552300 frame shift probably null
R5208:Sema4c UTSW 1 36550326 missense probably damaging 1.00
R5551:Sema4c UTSW 1 36552317 missense probably damaging 1.00
R5912:Sema4c UTSW 1 36554388 missense possibly damaging 0.83
R6578:Sema4c UTSW 1 36550753 missense probably benign 0.02
X0019:Sema4c UTSW 1 36552996 missense probably damaging 1.00
X0028:Sema4c UTSW 1 36549966 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GCATTTGAGTTCCGACCACC -3'
(R):5'- GAAAGCTACCTTGTTGCTGTC -3'

Sequencing Primer
(F):5'- TGAGTTCCGACCACCTCCTAGG -3'
(R):5'- TTGGAAAACCTGGGGCTC -3'
Posted On2015-01-23