Incidental Mutation 'R3276:Mag'
ID258212
Institutional Source Beutler Lab
Gene Symbol Mag
Ensembl Gene ENSMUSG00000036634
Gene Namemyelin-associated glycoprotein
SynonymsGma, siglec-4a
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3276 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location30899176-30914873 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 30901648 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040548] [ENSMUST00000187137] [ENSMUST00000188569] [ENSMUST00000191081]
Predicted Effect probably null
Transcript: ENSMUST00000040548
SMART Domains Protein: ENSMUSP00000041464
Gene: ENSMUSG00000036634

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 27 135 1.67e0 SMART
IG 144 237 4.38e0 SMART
IGc2 252 312 5.74e-13 SMART
IGc2 338 399 7.64e-9 SMART
transmembrane domain 511 533 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000187137
SMART Domains Protein: ENSMUSP00000139564
Gene: ENSMUSG00000036634

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 27 135 1.67e0 SMART
IG 144 237 4.38e0 SMART
IGc2 252 312 5.74e-13 SMART
IGc2 338 399 7.64e-9 SMART
transmembrane domain 511 533 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000188569
SMART Domains Protein: ENSMUSP00000140526
Gene: ENSMUSG00000036634

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 27 135 1.67e0 SMART
Blast:IG 152 195 1e-19 BLAST
IGc2 210 270 5.74e-13 SMART
IGc2 296 357 7.64e-9 SMART
transmembrane domain 469 491 N/A INTRINSIC
low complexity region 535 549 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000191081
SMART Domains Protein: ENSMUSP00000139881
Gene: ENSMUSG00000036634

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 27 135 6.7e-3 SMART
IG 144 237 1.8e-2 SMART
IGc2 252 312 2.4e-15 SMART
IGc2 338 399 3e-11 SMART
transmembrane domain 511 533 N/A INTRINSIC
low complexity region 577 591 N/A INTRINSIC
Meta Mutation Damage Score 0.666 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: This gene encodes a type I membrane protein and member of the immunoglobulin-like superfamily. It is expressed in myelinating glial cells, including oligodendrocytes of the central nervous system and Schwann cells of the peripheral nervous system. Mice lacking the encoded protein express abundant myelin, but suffer long-term axon degeneration, altered distribution of channels and adhesion molecules at nodes of Ranvier, and altered axon cytoskeletal structure. While not required for myelination, the encoded protein enhances axon-myelin stability, helps to structure nodes of Ranvier, and regulates the axon cytoskeleton. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygotes for targeted null mutations exhibit delayed CNS myelination, late myelin degeneration in peripheral nerves, hypomyelination of optic nerves, and subtle intention tremors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 C T 8: 86,506,866 R1269H probably damaging Het
Ace A G 11: 105,976,702 E164G probably null Het
Als2 A T 1: 59,170,008 V1464E possibly damaging Het
Atox1 A G 11: 55,450,553 L52P possibly damaging Het
Btnl10 A G 11: 58,922,390 K282E probably benign Het
Cdkn3 T C 14: 46,771,477 probably benign Het
Col16a1 A G 4: 130,057,999 K72E probably damaging Het
Col6a5 G A 9: 105,911,107 R1565* probably null Het
Col6a6 T C 9: 105,786,230 H36R probably benign Het
Cyp4b1 T C 4: 115,625,850 N415D possibly damaging Het
Dennd4a G T 9: 64,888,993 R767L probably damaging Het
Dhcr24 T C 4: 106,561,239 F25L probably benign Het
Dhrs3 A G 4: 144,923,940 T219A probably benign Het
Dhx58 A G 11: 100,696,979 F584S probably damaging Het
Dmbt1 A G 7: 131,088,071 T715A probably benign Het
Eogt T A 6: 97,131,394 I229F probably benign Het
Ern2 T C 7: 122,180,964 T164A possibly damaging Het
Fam133b A T 5: 3,558,522 N84I probably damaging Het
Fbxl21 T A 13: 56,537,122 Y346* probably null Het
Fcgbp C A 7: 28,091,661 H782Q probably damaging Het
Gm11492 T C 11: 87,567,244 V148A possibly damaging Het
Gm5592 A G 7: 41,288,380 E362G probably benign Het
Golga3 T C 5: 110,201,998 probably benign Het
Gpatch2l A G 12: 86,244,315 T91A possibly damaging Het
Hsp90aa1 T A 12: 110,695,680 M1L possibly damaging Het
Hsp90aa1 C A 12: 110,695,681 probably null Het
Itgad C A 7: 128,190,981 H651N possibly damaging Het
Itgav A G 2: 83,776,542 D409G probably damaging Het
Kcnt2 A G 1: 140,609,639 N1119S probably benign Het
Klhl32 T C 4: 24,682,063 I207V probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lhfpl5 T C 17: 28,579,946 I143T possibly damaging Het
Lrrk1 T C 7: 66,305,521 K431E possibly damaging Het
Maml3 A T 3: 51,856,930 N204K possibly damaging Het
Mrpl19 T C 6: 81,964,066 S115G probably damaging Het
Mthfd1l G C 10: 4,148,025 G954A probably damaging Het
Mut A G 17: 40,958,872 probably null Het
Myo19 A G 11: 84,892,175 I172V probably benign Het
Naca T C 10: 128,040,661 probably benign Het
Nfatc2 T C 2: 168,506,994 N638D possibly damaging Het
Nsun6 A G 2: 15,009,404 probably benign Het
Olfr1412 A G 1: 92,588,813 N161S probably benign Het
Olfr584 C A 7: 103,085,750 D72E probably damaging Het
Olfr913 T A 9: 38,594,643 C141S probably damaging Het
Padi6 A G 4: 140,735,389 L307P probably damaging Het
Pafah1b1 G A 11: 74,690,232 S57F probably damaging Het
Prcd A G 11: 116,659,811 E103G possibly damaging Het
Prkx A T X: 77,771,275 F260I probably damaging Het
Rad54l2 A G 9: 106,753,943 probably null Het
Ranbp1 T C 16: 18,247,429 probably benign Het
Rb1cc1 T A 1: 6,249,366 M1003K probably benign Het
Scap A T 9: 110,374,025 M256L probably benign Het
Sema4c C T 1: 36,549,879 R722H possibly damaging Het
Sgk1 C T 10: 21,996,601 R171W probably damaging Het
Spata7 A G 12: 98,637,598 N75D possibly damaging Het
Tmem120b T A 5: 123,114,104 I146N probably damaging Het
Ttc23l A G 15: 10,547,232 F99L possibly damaging Het
Ube3a T A 7: 59,276,519 C348* probably null Het
Ubr4 T A 4: 139,421,855 D1777E probably benign Het
Unc79 C A 12: 103,113,217 D1880E probably damaging Het
Usp36 C T 11: 118,276,759 probably null Het
Zswim9 T C 7: 13,277,270 T51A possibly damaging Het
Other mutations in Mag
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01716:Mag APN 7 30900387 missense probably benign 0.00
IGL02036:Mag APN 7 30908452 missense probably damaging 0.97
IGL03263:Mag APN 7 30899528 unclassified probably null
regie UTSW 7 30900729 missense probably damaging 0.98
R0005:Mag UTSW 7 30908354 splice site probably benign
R0403:Mag UTSW 7 30906980 missense probably damaging 1.00
R1590:Mag UTSW 7 30901852 missense probably damaging 0.99
R1874:Mag UTSW 7 30909051 missense probably benign 0.13
R2170:Mag UTSW 7 30908987 nonsense probably null
R2192:Mag UTSW 7 30900641 nonsense probably null
R3176:Mag UTSW 7 30901648 critical splice donor site probably null
R3177:Mag UTSW 7 30901648 critical splice donor site probably null
R3277:Mag UTSW 7 30901648 critical splice donor site probably null
R4540:Mag UTSW 7 30900729 missense probably damaging 0.98
R4635:Mag UTSW 7 30906923 missense probably damaging 1.00
R4704:Mag UTSW 7 30909173 missense probably damaging 1.00
R4891:Mag UTSW 7 30900368 missense probably benign 0.04
R4940:Mag UTSW 7 30909200 missense probably damaging 1.00
R4952:Mag UTSW 7 30909156 nonsense probably null
R6301:Mag UTSW 7 30900679 missense probably damaging 1.00
R6441:Mag UTSW 7 30907083 missense possibly damaging 0.65
R6951:Mag UTSW 7 30911433 missense possibly damaging 0.89
X0024:Mag UTSW 7 30907071 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTCAGCCTCCCATGTAGC -3'
(R):5'- TGTGTGGTAAAATCCAACCCG -3'

Sequencing Primer
(F):5'- CCATGTAGCTGGGATGGCAAATC -3'
(R):5'- GAACCCTCTGTGGCCTTTGAG -3'
Posted On2015-01-23