Incidental Mutation 'R0326:Adamts9'
ID25826
Institutional Source Beutler Lab
Gene Symbol Adamts9
Ensembl Gene ENSMUSG00000030022
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 9
Synonyms8430403M15Rik, E030027K14Rik, 1810011L16Rik
MMRRC Submission 038536-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0326 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location92772699-92943492 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 92858057 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 697 (C697*)
Ref Sequence ENSEMBL: ENSMUSP00000126498 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113438] [ENSMUST00000167391]
Predicted Effect probably null
Transcript: ENSMUST00000113438
AA Change: C1278*
SMART Domains Protein: ENSMUSP00000109065
Gene: ENSMUSG00000030022
AA Change: C1278*

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Pep_M12B_propep 49 207 1.8e-37 PFAM
low complexity region 234 247 N/A INTRINSIC
Pfam:Reprolysin_5 291 476 7.6e-17 PFAM
Pfam:Reprolysin_4 291 495 2e-11 PFAM
Pfam:Reprolysin 293 499 7.4e-29 PFAM
Pfam:Reprolysin_2 310 489 1e-13 PFAM
Pfam:Reprolysin_3 314 445 1.7e-14 PFAM
TSP1 591 643 2.15e-9 SMART
Pfam:ADAM_spacer1 753 871 7.3e-35 PFAM
TSP1 881 936 1.14e0 SMART
Blast:TSP1 938 993 2e-28 BLAST
TSP1 1000 1054 3.78e-5 SMART
TSP1 1055 1109 5.64e-4 SMART
TSP1 1110 1166 1.25e-5 SMART
TSP1 1186 1240 1.45e-6 SMART
TSP1 1242 1296 4.41e-6 SMART
TSP1 1328 1380 7.06e-5 SMART
TSP1 1381 1436 4.24e-8 SMART
TSP1 1440 1495 8.23e-6 SMART
TSP1 1496 1551 1.23e-4 SMART
TSP1 1552 1609 2e-4 SMART
TSP1 1611 1672 1.25e-5 SMART
TSP1 1676 1730 3.47e-4 SMART
Pfam:GON 1732 1930 1.6e-85 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125490
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130314
Predicted Effect probably null
Transcript: ENSMUST00000167391
AA Change: C697*
SMART Domains Protein: ENSMUSP00000126498
Gene: ENSMUSG00000030022
AA Change: C697*

DomainStartEndE-ValueType
TSP1 10 62 2.15e-9 SMART
Pfam:ADAM_spacer1 172 290 6.1e-35 PFAM
TSP1 300 355 1.14e0 SMART
Blast:TSP1 357 412 3e-28 BLAST
TSP1 419 473 3.78e-5 SMART
TSP1 474 528 5.64e-4 SMART
TSP1 529 585 1.25e-5 SMART
TSP1 605 659 1.45e-6 SMART
TSP1 661 715 4.41e-6 SMART
TSP1 747 799 7.06e-5 SMART
TSP1 800 855 4.24e-8 SMART
TSP1 859 914 8.23e-6 SMART
TSP1 915 970 1.23e-4 SMART
TSP1 971 1028 2e-4 SMART
TSP1 1030 1091 1.25e-5 SMART
TSP1 1095 1149 3.47e-4 SMART
Pfam:GON 1150 1350 2.1e-86 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203690
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.8%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. Members of the ADAMTS family have been implicated in the cleavage of proteoglycans, the control of organ shape during development, and the inhibition of angiogenesis. This gene is localized to chromosome 3p14.3-p14.2, an area known to be lost in hereditary renal tumors. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 C T 1: 130,742,898 P286S possibly damaging Het
Aagab T A 9: 63,619,162 S156T probably damaging Het
Abca14 T G 7: 120,224,419 Y390D probably damaging Het
Abcc2 T A 19: 43,825,947 I1122N possibly damaging Het
Adamts16 T C 13: 70,779,611 E503G possibly damaging Het
Adgrv1 T C 13: 81,474,993 D3837G possibly damaging Het
Aire T A 10: 78,042,599 R128S probably damaging Het
Alkbh2 A C 5: 114,123,950 *240E probably null Het
Als2 T C 1: 59,180,583 Y1191C probably damaging Het
Anapc5 A T 5: 122,814,604 V186E probably benign Het
Apob C T 12: 7,990,307 A548V probably damaging Het
B3galt4 A T 17: 33,950,748 V172E probably damaging Het
Bbs7 A C 3: 36,592,376 C432G possibly damaging Het
Cacna2d3 T A 14: 29,045,644 E758V probably damaging Het
Cactin T G 10: 81,322,662 L154R probably benign Het
Ccdc129 A T 6: 55,898,243 M393L possibly damaging Het
Ccdc88a A C 11: 29,461,021 R502S probably benign Het
Ccnf A T 17: 24,231,810 I398N possibly damaging Het
Chd1 A T 17: 15,768,566 D1527V probably damaging Het
Chd1 A T 17: 15,768,568 M1528L probably benign Het
Chrac1 G A 15: 73,092,826 probably null Het
Cln3 T G 7: 126,583,045 M1L probably damaging Het
Cnot6 T C 11: 49,677,436 Y442C probably damaging Het
Col19a1 A T 1: 24,285,051 probably null Het
Col1a2 T C 6: 4,537,838 F1116L unknown Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cops4 T G 5: 100,528,542 V53G probably damaging Het
Crnkl1 A G 2: 145,919,955 S561P probably benign Het
Ctnnb1 C A 9: 120,951,712 Q99K probably benign Het
Cxcr5 T C 9: 44,513,281 S360G probably benign Het
Dab2 G A 15: 6,418,316 V60M probably damaging Het
Ddx3y A T Y: 1,263,321 Y648* probably null Het
Dennd2a T A 6: 39,497,110 D430V probably damaging Het
Dsp G T 13: 38,192,870 E1544* probably null Het
Efcab7 A T 4: 99,831,394 M38L possibly damaging Het
Fto A G 8: 91,409,527 N141S probably damaging Het
Gabrp A G 11: 33,554,362 F318L probably damaging Het
Gm4737 T A 16: 46,153,883 D377V probably benign Het
Gmeb1 A C 4: 132,242,352 C103W probably damaging Het
Heatr9 T C 11: 83,514,539 D365G probably damaging Het
Hif3a G A 7: 17,044,400 R436W probably benign Het
Hint2 A G 4: 43,654,378 V145A probably damaging Het
Hmcn2 T A 2: 31,423,225 L3482* probably null Het
Hsd3b1 A T 3: 98,853,274 Y134N probably damaging Het
Impg2 T A 16: 56,260,485 V775E probably damaging Het
Ipo5 A G 14: 120,922,223 I154M probably benign Het
Itgad T A 7: 128,198,378 F893Y probably benign Het
Kdm4a T C 4: 118,161,706 R438G probably benign Het
Klk11 T A 7: 43,776,519 M1K probably null Het
Lama5 A T 2: 180,182,426 V2602D possibly damaging Het
Lrch3 T C 16: 32,979,500 S35P probably damaging Het
Mfn2 A G 4: 147,883,288 L441P probably damaging Het
Mgat4c A T 10: 102,388,704 I260F probably damaging Het
Mon1b T A 8: 113,637,743 S51T probably benign Het
Myh11 T C 16: 14,218,880 D993G probably benign Het
Myo1a A G 10: 127,716,297 N762D probably benign Het
Nacc2 A T 2: 26,060,333 Y464N probably damaging Het
Nckap1 A G 2: 80,553,370 I150T probably benign Het
Ndufv2 G T 17: 66,080,821 P119T probably damaging Het
Noc4l G A 5: 110,652,375 R95* probably null Het
Ntng1 A T 3: 110,135,503 Y2* probably null Het
Olfr1333 A T 4: 118,829,825 V205D possibly damaging Het
Olfr1423 C T 19: 12,036,161 V194I probably benign Het
Olfr1505 C T 19: 13,919,509 T163I probably benign Het
Olfr804 A G 10: 129,705,769 E297G possibly damaging Het
Oog4 T C 4: 143,439,203 N53D probably benign Het
Phkg2 T G 7: 127,573,903 L11R probably damaging Het
Pogz A G 3: 94,870,113 D368G probably damaging Het
Prex2 T A 1: 11,285,065 L1530Q probably damaging Het
Prmt1 C T 7: 44,979,454 E144K probably damaging Het
Prss8 T A 7: 127,927,176 I121F probably benign Het
Psmd13 T C 7: 140,897,711 L314P probably damaging Het
Ptch2 G A 4: 117,108,884 G467D probably damaging Het
Rbm20 C A 19: 53,864,165 P1192Q probably damaging Het
Rpl19 T A 11: 98,028,374 D45E probably benign Het
Rsph10b C T 5: 143,967,128 A219V probably damaging Het
Rtraf C T 14: 19,814,532 probably null Het
Scaf1 T A 7: 45,008,751 T235S probably damaging Het
Shank1 T A 7: 44,319,170 C296S unknown Het
Slc39a7 A T 17: 34,028,950 V426D probably damaging Het
Slc41a2 A T 10: 83,283,746 V384D probably damaging Het
Slco1c1 T C 6: 141,559,773 L475P probably benign Het
Slco6d1 A C 1: 98,490,634 K515T probably benign Het
Sos2 T C 12: 69,635,685 E253G probably damaging Het
Sp6 G T 11: 97,021,535 D25Y possibly damaging Het
Syt11 A C 3: 88,762,548 D12E possibly damaging Het
Taf2 A G 15: 55,047,460 L606P probably damaging Het
Tbc1d5 A G 17: 50,966,736 Y116H probably damaging Het
Tnfrsf8 A G 4: 145,288,459 I243T possibly damaging Het
Tnxb A G 17: 34,698,179 S2183G probably benign Het
Trim66 T C 7: 109,460,172 Y853C probably benign Het
Ttn T A 2: 76,737,495 T27685S probably damaging Het
Ttn T C 2: 76,743,122 E25809G probably damaging Het
Uvssa G A 5: 33,408,847 G445S probably benign Het
Zfp326 T C 5: 105,910,275 S427P probably damaging Het
Zfp592 A G 7: 81,024,889 T534A possibly damaging Het
Zfp672 A G 11: 58,316,347 S383P possibly damaging Het
Zfp799 A G 17: 32,820,726 S188P possibly damaging Het
Zyg11b A C 4: 108,272,253 V54G possibly damaging Het
Other mutations in Adamts9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Adamts9 APN 6 92859902 missense possibly damaging 0.90
IGL01352:Adamts9 APN 6 92860174 missense probably benign 0.00
IGL01462:Adamts9 APN 6 92894266 missense probably benign 0.04
IGL01551:Adamts9 APN 6 92807020 missense probably damaging 0.99
IGL01577:Adamts9 APN 6 92858147 splice site probably benign
IGL01638:Adamts9 APN 6 92872428 missense probably benign 0.19
IGL01757:Adamts9 APN 6 92796159 missense probably damaging 1.00
IGL02102:Adamts9 APN 6 92777439 missense probably benign 0.00
IGL02379:Adamts9 APN 6 92797033 missense probably damaging 0.97
IGL02419:Adamts9 APN 6 92796997 missense probably benign 0.04
IGL02554:Adamts9 APN 6 92880847 missense probably benign 0.01
IGL02832:Adamts9 APN 6 92807175 missense probably damaging 1.00
IGL03164:Adamts9 APN 6 92889937 missense probably damaging 1.00
IGL03347:Adamts9 APN 6 92887432 nonsense probably null
IGL03401:Adamts9 APN 6 92786868 missense probably damaging 0.97
Bluebeard UTSW 6 92879959 nonsense probably null
R0047:Adamts9 UTSW 6 92905306 unclassified probably benign
R0047:Adamts9 UTSW 6 92905306 unclassified probably benign
R0067:Adamts9 UTSW 6 92890167 missense probably damaging 0.98
R0141:Adamts9 UTSW 6 92943085 missense probably benign
R0396:Adamts9 UTSW 6 92798005 missense probably benign 0.00
R0490:Adamts9 UTSW 6 92872866 missense probably benign
R0504:Adamts9 UTSW 6 92912645 missense probably damaging 1.00
R0620:Adamts9 UTSW 6 92858113 missense possibly damaging 0.95
R0669:Adamts9 UTSW 6 92880957 missense probably damaging 1.00
R0682:Adamts9 UTSW 6 92903802 missense possibly damaging 0.80
R1412:Adamts9 UTSW 6 92796433 missense probably benign
R1433:Adamts9 UTSW 6 92849290 critical splice donor site probably null
R1558:Adamts9 UTSW 6 92908711 missense possibly damaging 0.87
R1661:Adamts9 UTSW 6 92880623 missense possibly damaging 0.92
R1801:Adamts9 UTSW 6 92863376 missense probably benign 0.27
R1855:Adamts9 UTSW 6 92901369 splice site probably benign
R1887:Adamts9 UTSW 6 92872788 critical splice donor site probably null
R1934:Adamts9 UTSW 6 92943121 missense possibly damaging 0.59
R1956:Adamts9 UTSW 6 92859849 missense probably damaging 1.00
R1986:Adamts9 UTSW 6 92796394 missense probably benign
R2370:Adamts9 UTSW 6 92860203 missense probably damaging 0.99
R2376:Adamts9 UTSW 6 92912831 missense probably benign
R2432:Adamts9 UTSW 6 92857900 missense probably damaging 1.00
R2876:Adamts9 UTSW 6 92795910 splice site probably benign
R3015:Adamts9 UTSW 6 92872932 missense probably benign 0.05
R3611:Adamts9 UTSW 6 92869984 missense probably benign 0.05
R4024:Adamts9 UTSW 6 92872784 splice site probably benign
R4292:Adamts9 UTSW 6 92795996 missense possibly damaging 0.95
R4403:Adamts9 UTSW 6 92859864 missense probably damaging 1.00
R4574:Adamts9 UTSW 6 92879959 nonsense probably null
R4677:Adamts9 UTSW 6 92816606 start codon destroyed probably null
R5114:Adamts9 UTSW 6 92890273 missense probably benign 0.03
R5260:Adamts9 UTSW 6 92807137 missense probably benign 0.00
R5384:Adamts9 UTSW 6 92798018 missense probably damaging 1.00
R5423:Adamts9 UTSW 6 92880697 missense possibly damaging 0.84
R5497:Adamts9 UTSW 6 92854365 missense probably damaging 1.00
R5629:Adamts9 UTSW 6 92798133 missense probably damaging 1.00
R5943:Adamts9 UTSW 6 92903786 missense probably benign 0.02
R6039:Adamts9 UTSW 6 92908546 missense possibly damaging 0.95
R6039:Adamts9 UTSW 6 92908546 missense possibly damaging 0.95
R6051:Adamts9 UTSW 6 92859926 missense possibly damaging 0.83
R6051:Adamts9 UTSW 6 92890118 missense probably damaging 1.00
R6082:Adamts9 UTSW 6 92889949 missense probably damaging 1.00
R6192:Adamts9 UTSW 6 92797021 missense probably damaging 1.00
R6291:Adamts9 UTSW 6 92890120 missense probably damaging 1.00
R6502:Adamts9 UTSW 6 92872335 missense probably damaging 1.00
R6818:Adamts9 UTSW 6 92905191 missense probably damaging 1.00
R6848:Adamts9 UTSW 6 92863354 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- GCAAGTGTGTGCCCATAATCTTTCG -3'
(R):5'- GTCAAGTCCTAAGCAGAAGAGCCC -3'

Sequencing Primer
(F):5'- TCGAAGGAACCAATTCTAGTCTGC -3'
(R):5'- tcacggctgattctgagac -3'
Posted On2013-04-16