Incidental Mutation 'R0326:Slco1c1'
ID25830
Institutional Source Beutler Lab
Gene Symbol Slco1c1
Ensembl Gene ENSMUSG00000030235
Gene Namesolute carrier organic anion transporter family, member 1c1
SynonymsSlc21a14, OATP-F
MMRRC Submission 038536-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R0326 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location141524368-141570177 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 141559773 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 475 (L475P)
Ref Sequence ENSEMBL: ENSMUSP00000032362 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032362] [ENSMUST00000135562] [ENSMUST00000203140] [ENSMUST00000204998] [ENSMUST00000205214]
Predicted Effect probably benign
Transcript: ENSMUST00000032362
AA Change: L475P

PolyPhen 2 Score 0.446 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000032362
Gene: ENSMUSG00000030235
AA Change: L475P

DomainStartEndE-ValueType
low complexity region 134 148 N/A INTRINSIC
low complexity region 152 168 N/A INTRINSIC
Pfam:MFS_1 181 464 1.1e-19 PFAM
KAZAL 478 518 1.21e0 SMART
transmembrane domain 644 666 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111837
AA Change: L476P

PolyPhen 2 Score 0.282 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000107468
Gene: ENSMUSG00000030235
AA Change: L476P

DomainStartEndE-ValueType
transmembrane domain 80 102 N/A INTRINSIC
transmembrane domain 112 134 N/A INTRINSIC
low complexity region 135 149 N/A INTRINSIC
low complexity region 153 169 N/A INTRINSIC
Pfam:MFS_1 182 465 3.8e-18 PFAM
KAZAL 479 519 7.8e-3 SMART
transmembrane domain 559 581 N/A INTRINSIC
transmembrane domain 594 616 N/A INTRINSIC
transmembrane domain 645 667 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135562
SMART Domains Protein: ENSMUSP00000138093
Gene: ENSMUSG00000030235

DomainStartEndE-ValueType
Pfam:OATP 42 469 2.1e-135 PFAM
Pfam:Sugar_tr 175 460 2.9e-7 PFAM
Pfam:MFS_1 181 463 3.8e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203140
AA Change: L357P

PolyPhen 2 Score 0.282 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000145058
Gene: ENSMUSG00000030235
AA Change: L357P

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
low complexity region 34 50 N/A INTRINSIC
Pfam:MFS_1 63 346 2e-18 PFAM
KAZAL 360 400 7.8e-3 SMART
transmembrane domain 437 459 N/A INTRINSIC
transmembrane domain 474 496 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204998
Predicted Effect probably benign
Transcript: ENSMUST00000205214
AA Change: L426P

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000144889
Gene: ENSMUSG00000030235
AA Change: L426P

DomainStartEndE-ValueType
Pfam:OATP 44 176 1.3e-35 PFAM
Pfam:MFS_1 169 415 1.1e-10 PFAM
KAZAL 429 469 7.8e-3 SMART
transmembrane domain 509 531 N/A INTRINSIC
transmembrane domain 544 566 N/A INTRINSIC
transmembrane domain 595 617 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.8%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the organic anion transporter family. The encoded protein is a transmembrane receptor that mediates the sodium-independent uptake of thyroid hormones in brain tissues. This protein has particularly high affinity for the thyroid hormones thyroxine, tri-iodothyronine and reverse tri-iodothyronine. Polymorphisms in the gene encoding this protein may be associated with fatigue and depression in patients suffering from hyperthyroidism. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased thyroxine and triiodothyronine levels in the forebrain, in the absence of overt growth, reproductive or neurological abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 C T 1: 130,742,898 P286S possibly damaging Het
Aagab T A 9: 63,619,162 S156T probably damaging Het
Abca14 T G 7: 120,224,419 Y390D probably damaging Het
Abcc2 T A 19: 43,825,947 I1122N possibly damaging Het
Adamts16 T C 13: 70,779,611 E503G possibly damaging Het
Adamts9 A T 6: 92,858,057 C697* probably null Het
Adgrv1 T C 13: 81,474,993 D3837G possibly damaging Het
Aire T A 10: 78,042,599 R128S probably damaging Het
Alkbh2 A C 5: 114,123,950 *240E probably null Het
Als2 T C 1: 59,180,583 Y1191C probably damaging Het
Anapc5 A T 5: 122,814,604 V186E probably benign Het
Apob C T 12: 7,990,307 A548V probably damaging Het
B3galt4 A T 17: 33,950,748 V172E probably damaging Het
Bbs7 A C 3: 36,592,376 C432G possibly damaging Het
Cacna2d3 T A 14: 29,045,644 E758V probably damaging Het
Cactin T G 10: 81,322,662 L154R probably benign Het
Ccdc129 A T 6: 55,898,243 M393L possibly damaging Het
Ccdc88a A C 11: 29,461,021 R502S probably benign Het
Ccnf A T 17: 24,231,810 I398N possibly damaging Het
Chd1 A T 17: 15,768,566 D1527V probably damaging Het
Chd1 A T 17: 15,768,568 M1528L probably benign Het
Chrac1 G A 15: 73,092,826 probably null Het
Cln3 T G 7: 126,583,045 M1L probably damaging Het
Cnot6 T C 11: 49,677,436 Y442C probably damaging Het
Col19a1 A T 1: 24,285,051 probably null Het
Col1a2 T C 6: 4,537,838 F1116L unknown Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cops4 T G 5: 100,528,542 V53G probably damaging Het
Crnkl1 A G 2: 145,919,955 S561P probably benign Het
Ctnnb1 C A 9: 120,951,712 Q99K probably benign Het
Cxcr5 T C 9: 44,513,281 S360G probably benign Het
Dab2 G A 15: 6,418,316 V60M probably damaging Het
Ddx3y A T Y: 1,263,321 Y648* probably null Het
Dennd2a T A 6: 39,497,110 D430V probably damaging Het
Dsp G T 13: 38,192,870 E1544* probably null Het
Efcab7 A T 4: 99,831,394 M38L possibly damaging Het
Fto A G 8: 91,409,527 N141S probably damaging Het
Gabrp A G 11: 33,554,362 F318L probably damaging Het
Gm4737 T A 16: 46,153,883 D377V probably benign Het
Gmeb1 A C 4: 132,242,352 C103W probably damaging Het
Heatr9 T C 11: 83,514,539 D365G probably damaging Het
Hif3a G A 7: 17,044,400 R436W probably benign Het
Hint2 A G 4: 43,654,378 V145A probably damaging Het
Hmcn2 T A 2: 31,423,225 L3482* probably null Het
Hsd3b1 A T 3: 98,853,274 Y134N probably damaging Het
Impg2 T A 16: 56,260,485 V775E probably damaging Het
Ipo5 A G 14: 120,922,223 I154M probably benign Het
Itgad T A 7: 128,198,378 F893Y probably benign Het
Kdm4a T C 4: 118,161,706 R438G probably benign Het
Klk11 T A 7: 43,776,519 M1K probably null Het
Lama5 A T 2: 180,182,426 V2602D possibly damaging Het
Lrch3 T C 16: 32,979,500 S35P probably damaging Het
Mfn2 A G 4: 147,883,288 L441P probably damaging Het
Mgat4c A T 10: 102,388,704 I260F probably damaging Het
Mon1b T A 8: 113,637,743 S51T probably benign Het
Myh11 T C 16: 14,218,880 D993G probably benign Het
Myo1a A G 10: 127,716,297 N762D probably benign Het
Nacc2 A T 2: 26,060,333 Y464N probably damaging Het
Nckap1 A G 2: 80,553,370 I150T probably benign Het
Ndufv2 G T 17: 66,080,821 P119T probably damaging Het
Noc4l G A 5: 110,652,375 R95* probably null Het
Ntng1 A T 3: 110,135,503 Y2* probably null Het
Olfr1333 A T 4: 118,829,825 V205D possibly damaging Het
Olfr1423 C T 19: 12,036,161 V194I probably benign Het
Olfr1505 C T 19: 13,919,509 T163I probably benign Het
Olfr804 A G 10: 129,705,769 E297G possibly damaging Het
Oog4 T C 4: 143,439,203 N53D probably benign Het
Phkg2 T G 7: 127,573,903 L11R probably damaging Het
Pogz A G 3: 94,870,113 D368G probably damaging Het
Prex2 T A 1: 11,285,065 L1530Q probably damaging Het
Prmt1 C T 7: 44,979,454 E144K probably damaging Het
Prss8 T A 7: 127,927,176 I121F probably benign Het
Psmd13 T C 7: 140,897,711 L314P probably damaging Het
Ptch2 G A 4: 117,108,884 G467D probably damaging Het
Rbm20 C A 19: 53,864,165 P1192Q probably damaging Het
Rpl19 T A 11: 98,028,374 D45E probably benign Het
Rsph10b C T 5: 143,967,128 A219V probably damaging Het
Rtraf C T 14: 19,814,532 probably null Het
Scaf1 T A 7: 45,008,751 T235S probably damaging Het
Shank1 T A 7: 44,319,170 C296S unknown Het
Slc39a7 A T 17: 34,028,950 V426D probably damaging Het
Slc41a2 A T 10: 83,283,746 V384D probably damaging Het
Slco6d1 A C 1: 98,490,634 K515T probably benign Het
Sos2 T C 12: 69,635,685 E253G probably damaging Het
Sp6 G T 11: 97,021,535 D25Y possibly damaging Het
Syt11 A C 3: 88,762,548 D12E possibly damaging Het
Taf2 A G 15: 55,047,460 L606P probably damaging Het
Tbc1d5 A G 17: 50,966,736 Y116H probably damaging Het
Tnfrsf8 A G 4: 145,288,459 I243T possibly damaging Het
Tnxb A G 17: 34,698,179 S2183G probably benign Het
Trim66 T C 7: 109,460,172 Y853C probably benign Het
Ttn T A 2: 76,737,495 T27685S probably damaging Het
Ttn T C 2: 76,743,122 E25809G probably damaging Het
Uvssa G A 5: 33,408,847 G445S probably benign Het
Zfp326 T C 5: 105,910,275 S427P probably damaging Het
Zfp592 A G 7: 81,024,889 T534A possibly damaging Het
Zfp672 A G 11: 58,316,347 S383P possibly damaging Het
Zfp799 A G 17: 32,820,726 S188P possibly damaging Het
Zyg11b A C 4: 108,272,253 V54G possibly damaging Het
Other mutations in Slco1c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Slco1c1 APN 6 141569482 missense probably benign 0.00
IGL00766:Slco1c1 APN 6 141547883 missense probably damaging 1.00
IGL00825:Slco1c1 APN 6 141542142 missense probably damaging 1.00
IGL01380:Slco1c1 APN 6 141540051 missense probably damaging 1.00
IGL01583:Slco1c1 APN 6 141540067 missense probably damaging 1.00
IGL01877:Slco1c1 APN 6 141555153 missense probably damaging 0.98
IGL02601:Slco1c1 APN 6 141544829 missense probably damaging 1.00
IGL02852:Slco1c1 APN 6 141547824 nonsense probably null
IGL03058:Slco1c1 APN 6 141563187 missense probably benign 0.44
IGL03102:Slco1c1 APN 6 141544827 missense possibly damaging 0.63
R0101:Slco1c1 UTSW 6 141531510 missense probably damaging 0.99
R0755:Slco1c1 UTSW 6 141531532 missense probably damaging 0.99
R1335:Slco1c1 UTSW 6 141542127 missense probably damaging 1.00
R2011:Slco1c1 UTSW 6 141555107 missense probably benign 0.00
R2084:Slco1c1 UTSW 6 141559852 nonsense probably null
R2163:Slco1c1 UTSW 6 141559752 missense probably benign 0.25
R2190:Slco1c1 UTSW 6 141563167 missense probably benign 0.02
R2248:Slco1c1 UTSW 6 141546689 missense probably damaging 1.00
R2876:Slco1c1 UTSW 6 141559856 missense probably damaging 1.00
R3004:Slco1c1 UTSW 6 141532654 missense probably damaging 1.00
R3196:Slco1c1 UTSW 6 141531448 splice site probably null
R4444:Slco1c1 UTSW 6 141546691 missense possibly damaging 0.96
R4529:Slco1c1 UTSW 6 141555181 missense probably damaging 1.00
R4743:Slco1c1 UTSW 6 141564516 missense probably damaging 0.98
R5261:Slco1c1 UTSW 6 141546776 missense probably damaging 1.00
R5451:Slco1c1 UTSW 6 141559878 missense probably benign 0.04
R5558:Slco1c1 UTSW 6 141567496 missense probably damaging 0.97
R5813:Slco1c1 UTSW 6 141542203 missense probably damaging 1.00
R5836:Slco1c1 UTSW 6 141569314 missense probably damaging 1.00
R6084:Slco1c1 UTSW 6 141546770 missense probably benign 0.02
R6434:Slco1c1 UTSW 6 141547850 missense probably damaging 1.00
R6544:Slco1c1 UTSW 6 141531444 unclassified probably null
R6766:Slco1c1 UTSW 6 141547809 missense possibly damaging 0.49
R6865:Slco1c1 UTSW 6 141540052 missense probably damaging 1.00
R7050:Slco1c1 UTSW 6 141547926 missense probably damaging 1.00
R7164:Slco1c1 UTSW 6 141542129 nonsense probably null
R7255:Slco1c1 UTSW 6 141569325 missense probably benign 0.07
X0061:Slco1c1 UTSW 6 141532739 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCCAAAGACAGCAGGCACAATG -3'
(R):5'- TAGGGTCAGAACGAGAGCTTCCAC -3'

Sequencing Primer
(F):5'- GGCACAATGTCATAAATTGCCC -3'
(R):5'- GGGACTACTGAGTAGCCATTTAAC -3'
Posted On2013-04-16