Incidental Mutation 'R3408:Ilk'
ID258375
Institutional Source Beutler Lab
Gene Symbol Ilk
Ensembl Gene ENSMUSG00000030890
Gene Nameintegrin linked kinase
SynonymsESTM24
MMRRC Submission 040626-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3408 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location105736592-105742925 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 105740974 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 155 (M155L)
Ref Sequence ENSEMBL: ENSMUSP00000130341 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033179] [ENSMUST00000033182] [ENSMUST00000033184] [ENSMUST00000098148] [ENSMUST00000136687] [ENSMUST00000141116] [ENSMUST00000149695] [ENSMUST00000163389]
Predicted Effect probably benign
Transcript: ENSMUST00000033179
SMART Domains Protein: ENSMUSP00000033179
Gene: ENSMUSG00000030888

DomainStartEndE-ValueType
low complexity region 186 202 N/A INTRINSIC
Pfam:Methyltransf_8 238 457 2.4e-107 PFAM
Pfam:Methyltransf_11 314 391 2e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000033182
AA Change: M155L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000033182
Gene: ENSMUSG00000030890
AA Change: M155L

DomainStartEndE-ValueType
ANK 33 62 4.71e-6 SMART
ANK 66 95 1.04e-7 SMART
ANK 99 128 1.02e-1 SMART
Pfam:Pkinase 193 445 1.5e-25 PFAM
Pfam:Pkinase_Tyr 193 446 7.2e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000033184
SMART Domains Protein: ENSMUSP00000033184
Gene: ENSMUSG00000030894

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
Pro-kuma_activ 32 176 4.53e-50 SMART
low complexity region 177 189 N/A INTRINSIC
Pfam:Peptidase_S8 251 492 1.1e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000054556
Predicted Effect probably benign
Transcript: ENSMUST00000098148
SMART Domains Protein: ENSMUSP00000095752
Gene: ENSMUSG00000030888

DomainStartEndE-ValueType
low complexity region 232 248 N/A INTRINSIC
Pfam:Methyltransf_8 284 503 7.5e-107 PFAM
Pfam:Methyltransf_11 348 437 2.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127298
Predicted Effect probably benign
Transcript: ENSMUST00000130565
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131683
Predicted Effect probably benign
Transcript: ENSMUST00000136687
AA Change: M155L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000123443
Gene: ENSMUSG00000030890
AA Change: M155L

DomainStartEndE-ValueType
ANK 33 62 4.71e-6 SMART
ANK 66 95 1.04e-7 SMART
ANK 99 128 1.02e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137902
Predicted Effect probably benign
Transcript: ENSMUST00000141116
SMART Domains Protein: ENSMUSP00000118105
Gene: ENSMUSG00000043866

DomainStartEndE-ValueType
low complexity region 17 39 N/A INTRINSIC
low complexity region 45 91 N/A INTRINSIC
Pfam:TFIID_30kDa 128 177 6.1e-30 PFAM
low complexity region 181 192 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145123
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146999
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148971
Predicted Effect probably benign
Transcript: ENSMUST00000149695
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151108
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152508
Predicted Effect probably benign
Transcript: ENSMUST00000153557
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154626
Predicted Effect probably benign
Transcript: ENSMUST00000163389
AA Change: M155L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000130341
Gene: ENSMUSG00000030890
AA Change: M155L

DomainStartEndE-ValueType
ANK 33 62 4.71e-6 SMART
ANK 66 95 1.04e-7 SMART
ANK 99 128 1.02e-1 SMART
Pfam:Pkinase_Tyr 193 446 4e-39 PFAM
Pfam:Pkinase 195 445 3e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210840
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 89.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with a kinase-like domain and four ankyrin-like repeats. The encoded protein associates at the cell membrane with the cytoplasmic domain of beta integrins, where it regulates integrin-mediated signal transduction. Activity of this protein is important in the epithelial to mesenchymal transition, and over-expression of this gene is implicated in tumor growth and metastasis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2013]
PHENOTYPE: Nullizygous embryos do not polarize the epiblast and die after implantation. Mice with mutations in the ATP-binding site show aphagia, hunched posture, and neonatal death due to renal aplasia. Mice with mutations in the paxillin-binding site show vasculogenesis and growth defects, and die at ~E12.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430550D23Rik C T 2: 156,003,920 V6I probably benign Het
Adam17 T A 12: 21,329,118 K643N probably damaging Het
Adgrg4 A T X: 56,968,127 I2838F probably damaging Het
Aox2 G A 1: 58,343,668 V1036I probably benign Het
Bag3 AAAGG AAAGGAAGG 7: 128,545,769 probably null Het
Cacnb3 T C 15: 98,641,187 V167A probably benign Het
Clasrp C A 7: 19,585,240 probably benign Het
E2f7 C T 10: 110,784,717 T865M possibly damaging Het
Eef2 GCCC GCCCC 10: 81,178,767 probably null Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Ephb3 T A 16: 21,219,504 Y341N probably damaging Het
Frem1 A T 4: 83,011,986 V241E probably damaging Het
Gpi1 A G 7: 34,202,679 V500A probably damaging Het
Ipo8 T C 6: 148,821,709 D70G probably benign Het
Macf1 T C 4: 123,381,781 Q6283R probably damaging Het
Mfsd1 T A 3: 67,596,713 M346K possibly damaging Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Myo7a A T 7: 98,081,087 F758Y probably benign Het
Nalcn T A 14: 123,596,617 S49C probably null Het
Ncan G A 8: 70,112,151 T271I probably damaging Het
Nr5a2 C T 1: 136,940,498 A299T probably benign Het
Olfr1130 A T 2: 87,607,876 I163L probably benign Het
Olfr1279 A T 2: 111,306,505 Q100L probably damaging Het
Olfr1413 A G 1: 92,573,953 T261A probably damaging Het
Olfr638 G T 7: 104,003,343 E23* probably null Het
Piwil4 T C 9: 14,725,963 T352A probably damaging Het
Plch1 A G 3: 63,699,347 probably benign Het
Plekhg5 A G 4: 152,108,292 T559A probably damaging Het
Rfx2 G T 17: 56,803,526 D153E probably benign Het
Sh3bp4 G T 1: 89,145,047 C539F possibly damaging Het
Slco1b2 A T 6: 141,676,256 H479L probably benign Het
Tex37 C T 6: 70,915,706 S19N possibly damaging Het
Tmem150b G T 7: 4,724,340 F55L probably damaging Het
Vmn1r60 A T 7: 5,545,149 probably null Het
Vmn2r80 C T 10: 79,168,393 L147F possibly damaging Het
Vps50 A T 6: 3,600,212 K890N probably damaging Het
Other mutations in Ilk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02000:Ilk APN 7 105741169 missense probably benign 0.45
IGL02326:Ilk APN 7 105741633 missense probably damaging 1.00
IGL02969:Ilk APN 7 105740340 missense possibly damaging 0.71
IGL03115:Ilk APN 7 105740335 missense probably damaging 0.99
R3792:Ilk UTSW 7 105742087 nonsense probably null
R4879:Ilk UTSW 7 105741804 missense probably benign 0.00
R5011:Ilk UTSW 7 105742249 missense probably damaging 1.00
R5013:Ilk UTSW 7 105742249 missense probably damaging 1.00
R5147:Ilk UTSW 7 105742567 missense possibly damaging 0.87
R5689:Ilk UTSW 7 105741650 missense probably benign
R5837:Ilk UTSW 7 105741171 unclassified probably null
Predicted Primers PCR Primer
(F):5'- TTTTCAGGACCTGGTGGCTAAC -3'
(R):5'- AATACCGGAGTGTTTGTTCAGG -3'

Sequencing Primer
(F):5'- CTCTTGTGAGCATCTGTAACAAG -3'
(R):5'- GGGTCCCATTTCCTGAAAATATGAGC -3'
Posted On2015-01-23