Incidental Mutation 'R3409:Olfr25'
ID258421
Institutional Source Beutler Lab
Gene Symbol Olfr25
Ensembl Gene ENSMUSG00000058270
Gene Nameolfactory receptor 25
SynonymsGA_x6K02T2PVTD-32017922-32018863, MOR170-4, MTPCR18
MMRRC Submission 040627-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R3409 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location38329060-38335889 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 38330344 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 252 (S252R)
Ref Sequence ENSEMBL: ENSMUSP00000071393 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071449] [ENSMUST00000212354] [ENSMUST00000214155]
Predicted Effect possibly damaging
Transcript: ENSMUST00000071449
AA Change: S252R

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000071393
Gene: ENSMUSG00000058270
AA Change: S252R

DomainStartEndE-ValueType
Pfam:7tm_4 34 310 3.1e-46 PFAM
Pfam:7tm_1 44 243 8e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000212354
AA Change: S249R

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000214155
AA Change: S249R

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 91.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra3 A G 5: 50,001,930 V326A probably damaging Het
AI429214 C T 8: 36,993,917 S73L probably benign Het
Atp13a4 G T 16: 29,413,749 T923K probably damaging Het
Ccdc150 A G 1: 54,356,773 D805G probably benign Het
Ccdc185 T G 1: 182,748,748 Q125H possibly damaging Het
Ccdc88a T A 11: 29,486,006 C10S probably damaging Het
Cpsf1 G T 15: 76,601,781 Y396* probably null Het
Dnpep A G 1: 75,316,626 V33A probably damaging Het
Fbn1 G A 2: 125,412,665 A226V possibly damaging Het
Frmd4a A T 2: 4,153,028 probably benign Het
Gipr A G 7: 19,159,794 V318A possibly damaging Het
Gsdmc4 A G 15: 63,892,046 S401P probably benign Het
H2-M10.6 T A 17: 36,814,001 V270E probably damaging Het
Klhl7 G T 5: 24,138,321 V212L probably damaging Het
Krt10 C A 11: 99,387,261 R322L probably damaging Het
Lrrn4 A G 2: 132,879,861 L12P unknown Het
Mast2 C G 4: 116,310,910 E881Q possibly damaging Het
Nod1 G T 6: 54,944,917 R139S probably benign Het
Notch3 C T 17: 32,150,702 V772M possibly damaging Het
Nrxn1 G A 17: 90,208,367 T19M probably damaging Het
Nudcd1 T C 15: 44,420,811 M60V probably benign Het
Olfr1151 T A 2: 87,857,661 L162* probably null Het
Olfr1220 T C 2: 89,097,324 N201S possibly damaging Het
Olfr1231 A G 2: 89,303,373 F73S probably benign Het
Olfr1453 G C 19: 13,028,047 A94G probably benign Het
Olfr1510 T A 14: 52,410,361 R170S possibly damaging Het
Pcdhb6 A G 18: 37,335,892 E622G probably damaging Het
Pitrm1 G A 13: 6,578,481 A937T possibly damaging Het
Plxnb1 G A 9: 109,106,613 probably null Het
Ripk3 T G 14: 55,788,241 N54T probably damaging Het
Rpn2 C A 2: 157,290,652 A108E possibly damaging Het
Scaf11 A G 15: 96,414,864 V1432A probably damaging Het
Sec14l5 C T 16: 5,165,654 probably null Het
Serpina3n A G 12: 104,411,277 E263G possibly damaging Het
Six4 A G 12: 73,112,883 F101S probably damaging Het
Slc12a1 A G 2: 125,154,151 T75A probably benign Het
Slc26a9 T C 1: 131,763,944 S642P probably benign Het
Smu1 T C 4: 40,752,008 T183A probably benign Het
Sptb T G 12: 76,610,815 K1311Q possibly damaging Het
Tal2 A G 4: 53,785,843 N8S probably damaging Het
Tenm4 A G 7: 96,895,160 T2128A probably damaging Het
Tmem67 A T 4: 12,073,952 M288K probably benign Het
Ubr1 A C 2: 120,963,448 I85S probably benign Het
Vmn2r90 G T 17: 17,733,376 V601L probably benign Het
Zfhx4 C T 3: 5,403,358 P2859S probably benign Het
Other mutations in Olfr25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01363:Olfr25 APN 9 38329703 missense probably benign 0.01
IGL02044:Olfr25 APN 9 38330165 missense probably benign 0.16
IGL02698:Olfr25 APN 9 38330210 missense probably benign 0.03
IGL03084:Olfr25 APN 9 38330217 missense probably damaging 0.97
IGL03355:Olfr25 APN 9 38329656 missense probably benign 0.05
R0453:Olfr25 UTSW 9 38330171 missense probably benign 0.36
R1584:Olfr25 UTSW 9 38330131 missense possibly damaging 0.90
R1707:Olfr25 UTSW 9 38329901 missense probably damaging 0.99
R1719:Olfr25 UTSW 9 38330507 missense probably benign 0.23
R4810:Olfr25 UTSW 9 38330394 missense probably benign 0.00
R6271:Olfr25 UTSW 9 38330282 missense probably benign 0.09
R6621:Olfr25 UTSW 9 38330462 missense probably damaging 1.00
X0019:Olfr25 UTSW 9 38329959 missense probably damaging 1.00
X0027:Olfr25 UTSW 9 38329802 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- TCGGATCTCCTGCAGTAACACC -3'
(R):5'- GCAAACCAGCTCAAATTGTTTC -3'

Sequencing Primer
(F):5'- CACCTATCTCAATGAGCTTGTGAG -3'
(R):5'- ACCAGCTCAAATTGTTTCAATTAAC -3'
Posted On2015-01-23