Incidental Mutation 'R3409:Pitrm1'
ID258429
Institutional Source Beutler Lab
Gene Symbol Pitrm1
Ensembl Gene ENSMUSG00000021193
Gene Namepitrilysin metallepetidase 1
SynonymsNtup1, PreP, 2310012C15Rik, MP-1
MMRRC Submission 040627-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.919) question?
Stock #R3409 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location6548149-6580515 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 6578481 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 937 (A937T)
Ref Sequence ENSEMBL: ENSMUSP00000152229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021611] [ENSMUST00000021614] [ENSMUST00000138703] [ENSMUST00000142972] [ENSMUST00000154100] [ENSMUST00000222485]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021611
AA Change: A898T

PolyPhen 2 Score 0.585 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000021611
Gene: ENSMUSG00000021193
AA Change: A898T

DomainStartEndE-ValueType
Pfam:Peptidase_M16 93 188 1.8e-7 PFAM
Pfam:Peptidase_M16_C 244 431 4.7e-27 PFAM
M16C_associated 504 752 2.8e-114 SMART
Pfam:Peptidase_M16_C 771 958 2.8e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000021614
SMART Domains Protein: ENSMUSP00000021614
Gene: ENSMUSG00000021196

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
Pfam:PFK 25 332 4.7e-114 PFAM
Pfam:PFK 411 696 1.2e-96 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131648
Predicted Effect probably benign
Transcript: ENSMUST00000133041
SMART Domains Protein: ENSMUSP00000123662
Gene: ENSMUSG00000021196

DomainStartEndE-ValueType
Pfam:PFK 1 66 4.4e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138703
SMART Domains Protein: ENSMUSP00000117030
Gene: ENSMUSG00000021196

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
Pfam:PFK 24 334 6.7e-136 PFAM
Pfam:PFK 410 698 1.1e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142972
SMART Domains Protein: ENSMUSP00000114439
Gene: ENSMUSG00000021196

DomainStartEndE-ValueType
PDB:4OMT|A 1 179 2e-68 PDB
SCOP:d1pfka_ 2 158 7e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154100
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221431
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222061
Predicted Effect possibly damaging
Transcript: ENSMUST00000222485
AA Change: A937T

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 91.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an ATP-dependent metalloprotease that degrades post-cleavage mitochondrial transit peptides. The encoded protein binds zinc and can also degrade amyloid beta A4 protein, suggesting a possible role in Alzheimer's disease. [provided by RefSeq, Dec 2016]
PHENOTYPE: Homozygous null mice show complete preweaning lethality. Heterozygotes show progressive ataxia, neurodegeneration, and accumulation of amyloid beta deposits. Mitochondria show impaired degradation rate of amyloid beta. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra3 A G 5: 50,001,930 V326A probably damaging Het
AI429214 C T 8: 36,993,917 S73L probably benign Het
Atp13a4 G T 16: 29,413,749 T923K probably damaging Het
Ccdc150 A G 1: 54,356,773 D805G probably benign Het
Ccdc185 T G 1: 182,748,748 Q125H possibly damaging Het
Ccdc88a T A 11: 29,486,006 C10S probably damaging Het
Cpsf1 G T 15: 76,601,781 Y396* probably null Het
Dnpep A G 1: 75,316,626 V33A probably damaging Het
Fbn1 G A 2: 125,412,665 A226V possibly damaging Het
Frmd4a A T 2: 4,153,028 probably benign Het
Gipr A G 7: 19,159,794 V318A possibly damaging Het
Gsdmc4 A G 15: 63,892,046 S401P probably benign Het
H2-M10.6 T A 17: 36,814,001 V270E probably damaging Het
Klhl7 G T 5: 24,138,321 V212L probably damaging Het
Krt10 C A 11: 99,387,261 R322L probably damaging Het
Lrrn4 A G 2: 132,879,861 L12P unknown Het
Mast2 C G 4: 116,310,910 E881Q possibly damaging Het
Nod1 G T 6: 54,944,917 R139S probably benign Het
Notch3 C T 17: 32,150,702 V772M possibly damaging Het
Nrxn1 G A 17: 90,208,367 T19M probably damaging Het
Nudcd1 T C 15: 44,420,811 M60V probably benign Het
Olfr1151 T A 2: 87,857,661 L162* probably null Het
Olfr1220 T C 2: 89,097,324 N201S possibly damaging Het
Olfr1231 A G 2: 89,303,373 F73S probably benign Het
Olfr1453 G C 19: 13,028,047 A94G probably benign Het
Olfr1510 T A 14: 52,410,361 R170S possibly damaging Het
Olfr25 T A 9: 38,330,344 S252R possibly damaging Het
Pcdhb6 A G 18: 37,335,892 E622G probably damaging Het
Plxnb1 G A 9: 109,106,613 probably null Het
Ripk3 T G 14: 55,788,241 N54T probably damaging Het
Rpn2 C A 2: 157,290,652 A108E possibly damaging Het
Scaf11 A G 15: 96,414,864 V1432A probably damaging Het
Sec14l5 C T 16: 5,165,654 probably null Het
Serpina3n A G 12: 104,411,277 E263G possibly damaging Het
Six4 A G 12: 73,112,883 F101S probably damaging Het
Slc12a1 A G 2: 125,154,151 T75A probably benign Het
Slc26a9 T C 1: 131,763,944 S642P probably benign Het
Smu1 T C 4: 40,752,008 T183A probably benign Het
Sptb T G 12: 76,610,815 K1311Q possibly damaging Het
Tal2 A G 4: 53,785,843 N8S probably damaging Het
Tenm4 A G 7: 96,895,160 T2128A probably damaging Het
Tmem67 A T 4: 12,073,952 M288K probably benign Het
Ubr1 A C 2: 120,963,448 I85S probably benign Het
Vmn2r90 G T 17: 17,733,376 V601L probably benign Het
Zfhx4 C T 3: 5,403,358 P2859S probably benign Het
Other mutations in Pitrm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Pitrm1 APN 13 6568666 missense probably damaging 1.00
IGL01148:Pitrm1 APN 13 6573105 missense probably benign
IGL01408:Pitrm1 APN 13 6573042 missense probably damaging 1.00
IGL01557:Pitrm1 APN 13 6552684 missense probably benign 0.37
IGL01803:Pitrm1 APN 13 6579435 missense probably benign 0.00
IGL02111:Pitrm1 APN 13 6573145 missense probably benign 0.45
IGL02217:Pitrm1 APN 13 6567341 splice site probably benign
IGL02539:Pitrm1 APN 13 6568756 missense probably benign 0.26
IGL02935:Pitrm1 APN 13 6553264 missense probably damaging 1.00
IGL03028:Pitrm1 APN 13 6574393 missense probably benign 0.00
IGL03112:Pitrm1 APN 13 6565008 missense probably benign 0.10
FR4737:Pitrm1 UTSW 13 6560596 critical splice acceptor site probably benign
FR4976:Pitrm1 UTSW 13 6560596 critical splice acceptor site probably benign
R0078:Pitrm1 UTSW 13 6575032 missense probably damaging 0.99
R0085:Pitrm1 UTSW 13 6549568 splice site probably benign
R0089:Pitrm1 UTSW 13 6555639 missense probably damaging 1.00
R0234:Pitrm1 UTSW 13 6575079 nonsense probably null
R0234:Pitrm1 UTSW 13 6575079 nonsense probably null
R0478:Pitrm1 UTSW 13 6559395 missense probably damaging 0.99
R0496:Pitrm1 UTSW 13 6568714 missense probably damaging 1.00
R0781:Pitrm1 UTSW 13 6558244 missense probably benign 0.03
R1061:Pitrm1 UTSW 13 6555575 missense probably damaging 0.99
R1110:Pitrm1 UTSW 13 6558244 missense probably benign 0.03
R1170:Pitrm1 UTSW 13 6552744 splice site probably benign
R1373:Pitrm1 UTSW 13 6570700 missense probably benign 0.03
R1563:Pitrm1 UTSW 13 6563470 missense possibly damaging 0.85
R1897:Pitrm1 UTSW 13 6560095 missense possibly damaging 0.78
R1985:Pitrm1 UTSW 13 6558184 missense probably damaging 1.00
R2075:Pitrm1 UTSW 13 6555383 missense probably damaging 1.00
R2114:Pitrm1 UTSW 13 6557773 missense probably damaging 1.00
R2115:Pitrm1 UTSW 13 6557773 missense probably damaging 1.00
R2206:Pitrm1 UTSW 13 6569291 missense probably damaging 1.00
R2207:Pitrm1 UTSW 13 6569291 missense probably damaging 1.00
R2260:Pitrm1 UTSW 13 6560125 missense probably damaging 1.00
R2568:Pitrm1 UTSW 13 6575092 missense probably benign 0.15
R3756:Pitrm1 UTSW 13 6558235 missense probably damaging 1.00
R4020:Pitrm1 UTSW 13 6556687 missense probably damaging 1.00
R4327:Pitrm1 UTSW 13 6579773 utr 3 prime probably benign
R4540:Pitrm1 UTSW 13 6555470 critical splice donor site probably null
R4579:Pitrm1 UTSW 13 6558225 missense probably benign 0.05
R4659:Pitrm1 UTSW 13 6553182 missense probably benign 0.37
R4685:Pitrm1 UTSW 13 6556542 missense probably benign 0.00
R4888:Pitrm1 UTSW 13 6578560 missense probably damaging 1.00
R5072:Pitrm1 UTSW 13 6553190 missense probably damaging 1.00
R5159:Pitrm1 UTSW 13 6567471 missense probably benign 0.00
R5383:Pitrm1 UTSW 13 6577432 missense probably damaging 1.00
R5470:Pitrm1 UTSW 13 6553270 missense probably benign 0.07
R5606:Pitrm1 UTSW 13 6560065 missense probably damaging 1.00
R6224:Pitrm1 UTSW 13 6565054 missense probably damaging 1.00
R6302:Pitrm1 UTSW 13 6560061 missense probably damaging 0.99
R6898:Pitrm1 UTSW 13 6555459 missense probably damaging 1.00
R7021:Pitrm1 UTSW 13 6578557 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCTTCCTGAGTCAGAGTTAAATGC -3'
(R):5'- TCATTTGAGCACAGAGACAGG -3'

Sequencing Primer
(F):5'- CCTGAGTCAGAGTTAAATGCTTCAG -3'
(R):5'- CCTTTATCGGATGGAGCA -3'
Posted On2015-01-23