Incidental Mutation 'R3701:Ttc34'
ID258511
Institutional Source Beutler Lab
Gene Symbol Ttc34
Ensembl Gene ENSMUSG00000046637
Gene Nametetratricopeptide repeat domain 34
Synonyms
MMRRC Submission 040694-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.199) question?
Stock #R3701 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location154837459-154867127 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 154865482 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 964 (F964S)
Ref Sequence ENSEMBL: ENSMUSP00000146409 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050220] [ENSMUST00000079269] [ENSMUST00000080559] [ENSMUST00000163732] [ENSMUST00000207854]
Predicted Effect possibly damaging
Transcript: ENSMUST00000050220
AA Change: F455S

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000051782
Gene: ENSMUSG00000046637
AA Change: F455S

DomainStartEndE-ValueType
Blast:TPR 38 68 4e-6 BLAST
low complexity region 69 85 N/A INTRINSIC
TPR 166 199 2.66e0 SMART
TPR 200 233 4.45e-2 SMART
TPR 294 327 9e1 SMART
Blast:TPR 328 361 2e-7 BLAST
TPR 412 445 8.77e1 SMART
TPR 452 485 1.78e-1 SMART
Blast:TPR 500 533 9e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000079269
SMART Domains Protein: ENSMUSP00000078252
Gene: ENSMUSG00000058183

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Peptidase_M13_N 99 498 1.7e-135 PFAM
Pfam:Peptidase_M13 559 767 1.2e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000080559
SMART Domains Protein: ENSMUSP00000079399
Gene: ENSMUSG00000058183

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Peptidase_M13_N 76 512 4.8e-131 PFAM
Pfam:Peptidase_M13 573 779 3.4e-71 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137684
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138795
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151696
Predicted Effect probably benign
Transcript: ENSMUST00000163732
SMART Domains Protein: ENSMUSP00000131753
Gene: ENSMUSG00000058183

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Peptidase_M13_N 99 498 1.7e-135 PFAM
Pfam:Peptidase_M13 559 765 3.3e-71 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000207854
AA Change: F964S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.11 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 97% (37/38)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 A C 15: 74,545,015 K757T probably damaging Het
Akr1c19 C T 13: 4,243,033 R263C probably damaging Het
Asxl1 A G 2: 153,399,344 T605A probably benign Het
Cacna1i A T 15: 80,381,071 probably benign Het
Clip4 A G 17: 71,799,008 D62G probably damaging Het
Cstf1 A G 2: 172,380,392 T357A probably benign Het
Cul5 T C 9: 53,629,216 K499E probably damaging Het
Cyld T A 8: 88,729,551 S407T probably benign Het
Dnph1 G A 17: 46,498,711 G101S possibly damaging Het
Esp38 A T 17: 39,955,221 R74* probably null Het
Fam189a2 T C 19: 23,979,467 E354G probably benign Het
Fdxr A T 11: 115,269,701 L336Q probably damaging Het
Hivep1 T C 13: 42,157,727 S1148P probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Itgb1bp2 T C X: 101,451,687 probably benign Het
Kcnj5 T C 9: 32,317,828 T25A possibly damaging Het
Lyn A G 4: 3,742,455 H28R probably benign Het
Nbeal1 C T 1: 60,251,413 probably benign Het
Nmur2 A G 11: 56,040,777 L36P probably damaging Het
Olfr114 G A 17: 37,589,826 Q176* probably null Het
Olfr1499 T G 19: 13,815,348 I81L probably benign Het
Olfr787 A T 10: 129,462,952 Y92F probably damaging Het
Pdgfra T A 5: 75,180,220 Y613* probably null Het
Phka2 T C X: 160,533,049 V230A possibly damaging Het
Pkd2l1 A G 19: 44,157,227 S186P probably damaging Het
Snx14 T C 9: 88,420,243 probably benign Het
Tex15 T C 8: 33,574,166 V1208A probably benign Het
Tmf1 A G 6: 97,172,331 F485S possibly damaging Het
Tnfsf4 G A 1: 161,417,207 V156I possibly damaging Het
Trdn C A 10: 33,334,984 Q391K probably damaging Het
Ttc37 T C 13: 76,113,679 I171T probably benign Het
Vmn2r104 A G 17: 20,029,556 S818P probably damaging Het
Zbed5 G A 5: 129,903,159 D650N possibly damaging Het
Zfp446 G A 7: 12,978,152 probably benign Het
Zfp592 C T 7: 81,037,411 R821* probably null Het
Zfp647 G A 15: 76,910,910 R517W probably damaging Het
Zfp983 G C 17: 21,661,539 E128Q probably damaging Het
Other mutations in Ttc34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03000:Ttc34 APN 4 154865431 missense probably damaging 1.00
IGL03034:Ttc34 APN 4 154861183 missense probably damaging 1.00
IGL03139:Ttc34 APN 4 154861270 missense probably benign 0.04
R1205:Ttc34 UTSW 4 154862214 missense probably benign 0.01
R1775:Ttc34 UTSW 4 154862214 missense probably benign 0.00
R1935:Ttc34 UTSW 4 154865682 missense possibly damaging 0.80
R1936:Ttc34 UTSW 4 154865682 missense possibly damaging 0.80
R1937:Ttc34 UTSW 4 154865682 missense possibly damaging 0.80
R1939:Ttc34 UTSW 4 154865682 missense possibly damaging 0.80
R1940:Ttc34 UTSW 4 154865682 missense possibly damaging 0.80
R5181:Ttc34 UTSW 4 154862246 missense probably benign 0.00
R5845:Ttc34 UTSW 4 154865472 missense probably benign 0.08
R6603:Ttc34 UTSW 4 154839305 missense probably benign 0.34
R6930:Ttc34 UTSW 4 154839086 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCACTAAGCTACTGTTCTTTGGC -3'
(R):5'- GTCCACTAGGAGTCCATTCTGG -3'

Sequencing Primer
(F):5'- AAGCTACTGTTCTTTGGCCATCC -3'
(R):5'- AAGTGCTCCTCCTCTAGACAG -3'
Posted On2015-01-23