Incidental Mutation 'R3701:Zfp647'
ID258534
Institutional Source Beutler Lab
Gene Symbol Zfp647
Ensembl Gene ENSMUSG00000054967
Gene Namezinc finger protein 647
Synonyms
MMRRC Submission 040694-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R3701 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location76910371-76925448 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 76910910 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 517 (R517W)
Ref Sequence ENSEMBL: ENSMUSP00000155685 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004072] [ENSMUST00000048854] [ENSMUST00000229055] [ENSMUST00000229183] [ENSMUST00000229865]
Predicted Effect probably benign
Transcript: ENSMUST00000004072
SMART Domains Protein: ENSMUSP00000004072
Gene: ENSMUSG00000003970

DomainStartEndE-ValueType
Ribosomal_L2 11 90 5.53e-33 SMART
Ribosomal_L2_C 96 231 6.56e-67 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000048854
AA Change: R517W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041575
Gene: ENSMUSG00000054967
AA Change: R517W

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
KRAB 17 77 7.05e-33 SMART
ZnF_C2H2 174 196 3.39e-3 SMART
ZnF_C2H2 202 224 1.2e-3 SMART
ZnF_C2H2 230 252 2.95e-3 SMART
ZnF_C2H2 258 280 4.79e-3 SMART
ZnF_C2H2 286 308 1.84e-4 SMART
ZnF_C2H2 314 336 6.32e-3 SMART
ZnF_C2H2 342 364 7.37e-4 SMART
ZnF_C2H2 370 392 1.6e-4 SMART
ZnF_C2H2 398 420 2.2e-2 SMART
ZnF_C2H2 426 448 6.78e-3 SMART
ZnF_C2H2 454 476 4.87e-4 SMART
ZnF_C2H2 482 504 2.24e-3 SMART
ZnF_C2H2 510 532 9.08e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000229055
AA Change: R517W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000229183
Predicted Effect probably benign
Transcript: ENSMUST00000229865
Meta Mutation Damage Score 0.0272 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 97% (37/38)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 A C 15: 74,545,015 K757T probably damaging Het
Akr1c19 C T 13: 4,243,033 R263C probably damaging Het
Asxl1 A G 2: 153,399,344 T605A probably benign Het
Cacna1i A T 15: 80,381,071 probably benign Het
Clip4 A G 17: 71,799,008 D62G probably damaging Het
Cstf1 A G 2: 172,380,392 T357A probably benign Het
Cul5 T C 9: 53,629,216 K499E probably damaging Het
Cyld T A 8: 88,729,551 S407T probably benign Het
Dnph1 G A 17: 46,498,711 G101S possibly damaging Het
Esp38 A T 17: 39,955,221 R74* probably null Het
Fam189a2 T C 19: 23,979,467 E354G probably benign Het
Fdxr A T 11: 115,269,701 L336Q probably damaging Het
Hivep1 T C 13: 42,157,727 S1148P probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Itgb1bp2 T C X: 101,451,687 probably benign Het
Kcnj5 T C 9: 32,317,828 T25A possibly damaging Het
Lyn A G 4: 3,742,455 H28R probably benign Het
Nbeal1 C T 1: 60,251,413 probably benign Het
Nmur2 A G 11: 56,040,777 L36P probably damaging Het
Olfr114 G A 17: 37,589,826 Q176* probably null Het
Olfr1499 T G 19: 13,815,348 I81L probably benign Het
Olfr787 A T 10: 129,462,952 Y92F probably damaging Het
Pdgfra T A 5: 75,180,220 Y613* probably null Het
Phka2 T C X: 160,533,049 V230A possibly damaging Het
Pkd2l1 A G 19: 44,157,227 S186P probably damaging Het
Snx14 T C 9: 88,420,243 probably benign Het
Tex15 T C 8: 33,574,166 V1208A probably benign Het
Tmf1 A G 6: 97,172,331 F485S possibly damaging Het
Tnfsf4 G A 1: 161,417,207 V156I possibly damaging Het
Trdn C A 10: 33,334,984 Q391K probably damaging Het
Ttc34 T C 4: 154,865,482 F964S probably damaging Het
Ttc37 T C 13: 76,113,679 I171T probably benign Het
Vmn2r104 A G 17: 20,029,556 S818P probably damaging Het
Zbed5 G A 5: 129,903,159 D650N possibly damaging Het
Zfp446 G A 7: 12,978,152 probably benign Het
Zfp592 C T 7: 81,037,411 R821* probably null Het
Zfp983 G C 17: 21,661,539 E128Q probably damaging Het
Other mutations in Zfp647
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01565:Zfp647 APN 15 76911670 nonsense probably null
IGL01680:Zfp647 APN 15 76917768 splice site probably benign
IGL02647:Zfp647 APN 15 76917715 missense probably damaging 1.00
IGL03213:Zfp647 APN 15 76911977 missense possibly damaging 0.46
IGL03401:Zfp647 APN 15 76911368 missense probably damaging 1.00
R0418:Zfp647 UTSW 15 76911386 missense probably damaging 1.00
R1479:Zfp647 UTSW 15 76911203 missense possibly damaging 0.94
R1913:Zfp647 UTSW 15 76911951 missense probably benign 0.02
R1959:Zfp647 UTSW 15 76911114 missense possibly damaging 0.57
R2176:Zfp647 UTSW 15 76911660 missense probably damaging 1.00
R3076:Zfp647 UTSW 15 76918009 start codon destroyed probably null
R3077:Zfp647 UTSW 15 76918009 start codon destroyed probably null
R3702:Zfp647 UTSW 15 76910910 missense probably damaging 1.00
R3960:Zfp647 UTSW 15 76910976 unclassified probably null
R4938:Zfp647 UTSW 15 76911044 frame shift probably null
R4939:Zfp647 UTSW 15 76911044 frame shift probably null
R5196:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R5197:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R5345:Zfp647 UTSW 15 76911495 missense possibly damaging 0.48
R5415:Zfp647 UTSW 15 76911393 missense possibly damaging 0.79
R5791:Zfp647 UTSW 15 76918006 missense unknown
R5942:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R5944:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R5945:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R5946:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R5947:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R6005:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R6007:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R6073:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R6074:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R6101:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R6102:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R6103:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R6126:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R6127:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R6129:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R6136:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R6151:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R6305:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R6306:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R6329:Zfp647 UTSW 15 76912085 missense probably damaging 0.96
R6721:Zfp647 UTSW 15 76911876 missense probably benign 0.00
R7158:Zfp647 UTSW 15 76917305 missense probably benign 0.01
R7239:Zfp647 UTSW 15 76911756 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGTAACAGAGTCCCCAAGGG -3'
(R):5'- AGCACTCGCATCTCATCCAG -3'

Sequencing Primer
(F):5'- GAACGACGATTCTGCACATG -3'
(R):5'- ACCCTTTCAGTGCACAGAGTG -3'
Posted On2015-01-23