Incidental Mutation 'R3701:Pkd2l1'
ID258547
Institutional Source Beutler Lab
Gene Symbol Pkd2l1
Ensembl Gene ENSMUSG00000037578
Gene Namepolycystic kidney disease 2-like 1
SynonymsPCL, PKD2L, Pkdl, polycystin-L, TRPP3
MMRRC Submission 040694-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R3701 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location44147637-44192442 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44157227 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 186 (S186P)
Ref Sequence ENSEMBL: ENSMUSP00000045675 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042026]
Predicted Effect probably damaging
Transcript: ENSMUST00000042026
AA Change: S186P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000045675
Gene: ENSMUSG00000037578
AA Change: S186P

DomainStartEndE-ValueType
transmembrane domain 105 127 N/A INTRINSIC
Pfam:PKD_channel 145 567 1.3e-172 PFAM
Pfam:Ion_trans 335 572 1.8e-30 PFAM
low complexity region 592 598 N/A INTRINSIC
SCOP:d2pvba_ 616 676 2e-4 SMART
PDB:4GIF|A 698 739 1e-17 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161357
Meta Mutation Damage Score 0.228 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the polycystin protein family. The encoded protein contains multiple transmembrane domains, and cytoplasmic N- and C-termini. The protein may be an integral membrane protein involved in cell-cell/matrix interactions. This protein functions as a calcium-regulated nonselective cation channel. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased chorda tympani nerve response to sour tastants. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 A C 15: 74,545,015 K757T probably damaging Het
Akr1c19 C T 13: 4,243,033 R263C probably damaging Het
Asxl1 A G 2: 153,399,344 T605A probably benign Het
Cacna1i A T 15: 80,381,071 probably benign Het
Clip4 A G 17: 71,799,008 D62G probably damaging Het
Cstf1 A G 2: 172,380,392 T357A probably benign Het
Cul5 T C 9: 53,629,216 K499E probably damaging Het
Cyld T A 8: 88,729,551 S407T probably benign Het
Dnph1 G A 17: 46,498,711 G101S possibly damaging Het
Esp38 A T 17: 39,955,221 R74* probably null Het
Fam189a2 T C 19: 23,979,467 E354G probably benign Het
Fdxr A T 11: 115,269,701 L336Q probably damaging Het
Hivep1 T C 13: 42,157,727 S1148P probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Itgb1bp2 T C X: 101,451,687 probably benign Het
Kcnj5 T C 9: 32,317,828 T25A possibly damaging Het
Lyn A G 4: 3,742,455 H28R probably benign Het
Nbeal1 C T 1: 60,251,413 probably benign Het
Nmur2 A G 11: 56,040,777 L36P probably damaging Het
Olfr114 G A 17: 37,589,826 Q176* probably null Het
Olfr1499 T G 19: 13,815,348 I81L probably benign Het
Olfr787 A T 10: 129,462,952 Y92F probably damaging Het
Pdgfra T A 5: 75,180,220 Y613* probably null Het
Phka2 T C X: 160,533,049 V230A possibly damaging Het
Snx14 T C 9: 88,420,243 probably benign Het
Tex15 T C 8: 33,574,166 V1208A probably benign Het
Tmf1 A G 6: 97,172,331 F485S possibly damaging Het
Tnfsf4 G A 1: 161,417,207 V156I possibly damaging Het
Trdn C A 10: 33,334,984 Q391K probably damaging Het
Ttc34 T C 4: 154,865,482 F964S probably damaging Het
Ttc37 T C 13: 76,113,679 I171T probably benign Het
Vmn2r104 A G 17: 20,029,556 S818P probably damaging Het
Zbed5 G A 5: 129,903,159 D650N possibly damaging Het
Zfp446 G A 7: 12,978,152 probably benign Het
Zfp592 C T 7: 81,037,411 R821* probably null Het
Zfp647 G A 15: 76,910,910 R517W probably damaging Het
Zfp983 G C 17: 21,661,539 E128Q probably damaging Het
Other mutations in Pkd2l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Pkd2l1 APN 19 44157636 critical splice donor site probably null
IGL00426:Pkd2l1 APN 19 44155605 missense probably benign 0.21
IGL00848:Pkd2l1 APN 19 44192279 utr 5 prime probably benign
IGL01315:Pkd2l1 APN 19 44192196 missense probably benign 0.09
IGL01654:Pkd2l1 APN 19 44154223 missense probably damaging 0.98
IGL01786:Pkd2l1 APN 19 44191442 missense probably damaging 0.96
IGL02174:Pkd2l1 APN 19 44157268 missense probably benign 0.04
IGL02648:Pkd2l1 APN 19 44155536 missense possibly damaging 0.72
R0654:Pkd2l1 UTSW 19 44157631 splice site probably null
R0762:Pkd2l1 UTSW 19 44150470 missense probably benign 0.19
R0981:Pkd2l1 UTSW 19 44154422 critical splice donor site probably null
R1114:Pkd2l1 UTSW 19 44191544 splice site probably benign
R1381:Pkd2l1 UTSW 19 44150463 missense probably benign 0.08
R1467:Pkd2l1 UTSW 19 44154209 missense possibly damaging 0.91
R1467:Pkd2l1 UTSW 19 44154209 missense possibly damaging 0.91
R1754:Pkd2l1 UTSW 19 44155601 nonsense probably null
R2009:Pkd2l1 UTSW 19 44155964 missense probably benign 0.01
R2125:Pkd2l1 UTSW 19 44154500 missense possibly damaging 0.91
R2696:Pkd2l1 UTSW 19 44157269 missense probably benign 0.01
R3001:Pkd2l1 UTSW 19 44155557 missense possibly damaging 0.81
R3002:Pkd2l1 UTSW 19 44155557 missense possibly damaging 0.81
R4179:Pkd2l1 UTSW 19 44192181 missense probably benign 0.01
R4180:Pkd2l1 UTSW 19 44192181 missense probably benign 0.01
R4614:Pkd2l1 UTSW 19 44154134 missense probably damaging 0.99
R4616:Pkd2l1 UTSW 19 44154134 missense probably damaging 0.99
R4617:Pkd2l1 UTSW 19 44154134 missense probably damaging 0.99
R4618:Pkd2l1 UTSW 19 44154134 missense probably damaging 0.99
R4762:Pkd2l1 UTSW 19 44155621 missense probably benign 0.09
R4893:Pkd2l1 UTSW 19 44153771 missense probably benign 0.00
R4907:Pkd2l1 UTSW 19 44154142 missense possibly damaging 0.95
R5004:Pkd2l1 UTSW 19 44149577 missense probably benign 0.00
R5380:Pkd2l1 UTSW 19 44157732 missense probably benign 0.33
R5480:Pkd2l1 UTSW 19 44192156 missense probably benign 0.18
R5950:Pkd2l1 UTSW 19 44152090 missense probably benign 0.27
R6248:Pkd2l1 UTSW 19 44157669 missense probably benign 0.00
R6908:Pkd2l1 UTSW 19 44152446 missense probably damaging 1.00
R6925:Pkd2l1 UTSW 19 44191508 missense possibly damaging 0.92
R7021:Pkd2l1 UTSW 19 44154208 missense probably damaging 0.98
R7322:Pkd2l1 UTSW 19 44157690 missense probably benign 0.00
R7378:Pkd2l1 UTSW 19 44153715 missense probably benign 0.05
R7442:Pkd2l1 UTSW 19 44157229 missense probably benign 0.01
X0026:Pkd2l1 UTSW 19 44157182 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCCCTACACTTTTGGCAG -3'
(R):5'- ACAGAGTTAGCGCAGTCAACTG -3'

Sequencing Primer
(F):5'- CTACACTTTTGGCAGGGGCTC -3'
(R):5'- TCAACTGTGGGAGTCCAAAC -3'
Posted On2015-01-23