Incidental Mutation 'R3702:Myot'
ID258585
Institutional Source Beutler Lab
Gene Symbol Myot
Ensembl Gene ENSMUSG00000024471
Gene Namemyotilin
SynonymsTtid, 5530402I04Rik
MMRRC Submission 040695-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3702 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location44334074-44355724 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to A at 44354095 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000111160 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025349] [ENSMUST00000115498]
Predicted Effect probably null
Transcript: ENSMUST00000025349
SMART Domains Protein: ENSMUSP00000025349
Gene: ENSMUSG00000024471

DomainStartEndE-ValueType
low complexity region 53 68 N/A INTRINSIC
IG 254 339 5.84e-5 SMART
IGc2 359 428 5.53e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000115498
SMART Domains Protein: ENSMUSP00000111160
Gene: ENSMUSG00000024471

DomainStartEndE-ValueType
low complexity region 53 68 N/A INTRINSIC
IG 254 339 5.84e-5 SMART
IGc2 359 428 5.53e-6 SMART
Meta Mutation Damage Score 0.6272 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cystoskeletal protein which plays a significant role in the stability of thin filaments during muscle contraction. This protein binds F-actin, crosslinks actin filaments, and prevents latrunculin A-induced filament disassembly. Mutations in this gene have been associated with limb-girdle muscular dystrophy and myofibrillar myopathies. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined.[provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a null allele are viable and fertile with normal skeletal and cardiac muscle morphology and function, growth rate, survival, and internal organ morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A T 13: 63,015,330 N55I probably benign Het
9530053A07Rik G A 7: 28,157,778 V2184M probably damaging Het
Abca5 C T 11: 110,288,058 probably null Het
Cacna1a T G 8: 84,617,846 S1846A probably damaging Het
Cacna1i A T 15: 80,381,071 probably benign Het
Calhm3 T A 19: 47,151,748 D302V possibly damaging Het
Cluh A G 11: 74,665,356 M878V probably benign Het
Col24a1 C T 3: 145,337,860 H603Y probably benign Het
Commd1 T A 11: 22,974,057 L277H probably damaging Het
Cpped1 G T 16: 11,828,440 D135E probably damaging Het
Cul5 T C 9: 53,629,216 K499E probably damaging Het
Elfn1 A G 5: 139,972,359 T373A probably benign Het
Fam83h C T 15: 76,002,650 R946K probably benign Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Grik4 T C 9: 42,675,218 K114E probably damaging Het
Hivep1 T C 13: 42,157,727 S1148P probably benign Het
Itgb1bp2 T C X: 101,451,687 probably benign Het
Lrp1 C A 10: 127,595,103 R359L probably damaging Het
Lyn A G 4: 3,742,455 H28R probably benign Het
Mtmr10 T C 7: 64,337,899 L729P probably damaging Het
Obox2 G T 7: 15,396,957 R38L probably benign Het
Olfr787 A T 10: 129,462,952 Y92F probably damaging Het
Pcdha3 A G 18: 36,947,348 Q381R probably benign Het
Pip4k2b A G 11: 97,729,548 probably benign Het
Ppig T A 2: 69,733,209 S89T probably damaging Het
Prune2 A G 19: 17,178,871 D47G probably damaging Het
Sh2b2 A G 5: 136,224,233 S362P probably damaging Het
Snap91 G A 9: 86,806,520 T322I probably damaging Het
Taf3 G A 2: 9,952,561 T112I possibly damaging Het
Tcea1 T C 1: 4,894,935 V276A probably benign Het
Tex15 T C 8: 33,574,166 V1208A probably benign Het
Tomm40 G T 7: 19,713,673 T144K possibly damaging Het
Zbed5 G A 5: 129,903,159 D650N possibly damaging Het
Zfp326 A G 5: 105,888,843 probably null Het
Zfp647 G A 15: 76,910,910 R517W probably damaging Het
Other mutations in Myot
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Myot APN 18 44337114 missense possibly damaging 0.85
IGL02117:Myot APN 18 44355110 missense probably benign 0.36
IGL02812:Myot APN 18 44346060 missense probably damaging 1.00
R0178:Myot UTSW 18 44336986 missense probably damaging 1.00
R1512:Myot UTSW 18 44342355 missense probably damaging 1.00
R1620:Myot UTSW 18 44337058 missense possibly damaging 0.48
R2140:Myot UTSW 18 44354125 missense possibly damaging 0.53
R2234:Myot UTSW 18 44354272 missense probably damaging 0.98
R2235:Myot UTSW 18 44354272 missense probably damaging 0.98
R2568:Myot UTSW 18 44337216 missense probably benign 0.02
R4967:Myot UTSW 18 44354928 missense possibly damaging 0.68
R5154:Myot UTSW 18 44354214 missense probably benign
R5250:Myot UTSW 18 44346070 missense probably damaging 1.00
R5322:Myot UTSW 18 44354149 missense probably benign 0.05
R7110:Myot UTSW 18 44341386 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACCCCTTCATGATAAAAGTCTTGG -3'
(R):5'- TCACCTTATCCGATCAGTGTTG -3'

Sequencing Primer
(F):5'- TCAGGAATTCAAGGCCCATAG -3'
(R):5'- AGTGTTGAACTGGACCATTTCATTG -3'
Posted On2015-01-23