Incidental Mutation 'R3704:Asap3'
List |< first << previous [record 34 of 686] next >> last >|
ID258643
Institutional Source Beutler Lab
Gene Symbol Asap3
Ensembl Gene ENSMUSG00000036995
Gene NameArfGAP with SH3 domain, ankyrin repeat and PH domain 3
SynonymsUPLC1, 9430088F20Rik, Ddefl1
MMRRC Submission 040697-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.163) question?
Stock #R3704 (G1)
Quality Score217
Status Validated
Chromosome4
Chromosomal Location136206365-136245216 bp(+) (GRCm38)
Type of Mutationsmall insertion (1 aa in frame mutation)
DNA Base Change (assembly) TGAGGAGGAGGAGGAGGA to TGAGGAGGAGGAGGAGGAGGA at 136241241 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000041899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047526]
Predicted Effect probably benign
Transcript: ENSMUST00000047526
SMART Domains Protein: ENSMUSP00000041899
Gene: ENSMUSG00000036995

DomainStartEndE-ValueType
low complexity region 22 29 N/A INTRINSIC
Pfam:BAR_3 32 264 5.5e-20 PFAM
PH 303 396 5.61e-17 SMART
ArfGap 425 547 8.33e-31 SMART
ANK 584 616 4.86e1 SMART
ANK 620 649 3.06e-5 SMART
low complexity region 794 806 N/A INTRINSIC
Meta Mutation Damage Score 0.1156 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 91.8%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a subfamily of ADP-ribosylation factor(Arf) GTPase-activating proteins that contain additional ankyrin repeat and pleckstrin homology domains. The Arf GAP domain of this protein catalyzes the hydrolysis of GTP bound to Arf proteins. The encoded protein promotes cell differentiation and migration and has been implicated in cancer cell invasion. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2009]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 T C 11: 48,947,976 T595A possibly damaging Het
Akap13 T C 7: 75,666,550 C585R probably damaging Het
Akr1b10 G T 6: 34,394,754 D285Y probably damaging Het
Akr1b10 A G 6: 34,394,755 D257G probably benign Het
Ankrd17 A T 5: 90,243,969 N1838K possibly damaging Het
Bcap29 T C 12: 31,617,152 H170R probably benign Het
Brwd3 A G X: 108,760,415 probably benign Het
Capn1 T C 19: 6,007,371 E349G probably damaging Het
Cd27 C T 6: 125,233,398 C222Y probably damaging Het
Cdh12 C A 15: 21,583,826 T584K probably damaging Het
Col13a1 A G 10: 61,867,829 probably null Het
Col22a1 T C 15: 71,970,307 T443A probably damaging Het
Crisp3 A G 17: 40,235,957 probably benign Het
Cubn T A 2: 13,350,943 H1826L probably damaging Het
Eci2 A G 13: 34,993,233 probably benign Het
Fat2 A C 11: 55,309,650 F866C probably damaging Het
Fbxl7 C A 15: 26,543,755 G269C probably damaging Het
Hjurp G C 1: 88,277,215 probably benign Het
Ifi35 G A 11: 101,448,604 M1I probably null Het
Jarid2 A G 13: 44,902,355 T308A probably benign Het
Kcnq3 A G 15: 66,021,739 probably null Het
Kcnt2 C T 1: 140,533,968 T819M probably damaging Het
Kifc3 G A 8: 95,104,028 probably benign Het
Mill1 A G 7: 18,263,053 T190A possibly damaging Het
Mosmo A G 7: 120,730,605 I150V probably damaging Het
Nemf C A 12: 69,331,130 D566Y probably damaging Het
Nisch A G 14: 31,176,745 probably benign Het
Olfr888 T A 9: 38,109,003 F106I possibly damaging Het
Paip2 A G 18: 35,610,921 T9A probably benign Het
Pde5a T C 3: 122,779,019 S318P probably benign Het
Plcd1 T C 9: 119,076,209 I145V possibly damaging Het
Prl2c2 C T 13: 13,002,225 R37H probably damaging Het
Raet1e A G 10: 22,180,845 T107A probably benign Het
Reps1 T G 10: 18,107,680 F424V probably damaging Het
Skint6 A T 4: 113,136,472 V401D possibly damaging Het
Srgn T C 10: 62,497,830 D56G probably damaging Het
Tmem63a G A 1: 180,963,114 D446N possibly damaging Het
Ttn A T 2: 76,831,780 probably benign Het
Ugt2b37 A T 5: 87,242,987 F340L possibly damaging Het
Xirp1 T A 9: 120,016,907 Q970L probably benign Het
Zfr2 T G 10: 81,246,079 V493G probably benign Het
Zmat4 A G 8: 23,797,414 R59G probably benign Het
Other mutations in Asap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00586:Asap3 APN 4 136206568 missense probably damaging 1.00
IGL01865:Asap3 APN 4 136236404 missense probably damaging 1.00
IGL02045:Asap3 APN 4 136227441 missense probably benign 0.01
IGL02105:Asap3 APN 4 136228474 critical splice donor site probably null
IGL02135:Asap3 APN 4 136241153 critical splice acceptor site probably null
IGL02484:Asap3 APN 4 136229457 splice site probably benign
IGL02524:Asap3 APN 4 136238616 missense probably damaging 1.00
IGL02881:Asap3 APN 4 136239237 missense probably benign 0.00
R0128:Asap3 UTSW 4 136234604 missense probably damaging 0.99
R0883:Asap3 UTSW 4 136234325 splice site probably benign
R0903:Asap3 UTSW 4 136238376 missense probably benign
R1073:Asap3 UTSW 4 136236431 missense probably damaging 1.00
R1498:Asap3 UTSW 4 136239194 missense probably benign
R1951:Asap3 UTSW 4 136227456 nonsense probably null
R1953:Asap3 UTSW 4 136227456 nonsense probably null
R3703:Asap3 UTSW 4 136241241 small insertion probably benign
R3705:Asap3 UTSW 4 136241241 small insertion probably benign
R3754:Asap3 UTSW 4 136229455 splice site probably null
R3773:Asap3 UTSW 4 136227575 missense probably benign 0.22
R3911:Asap3 UTSW 4 136229457 splice site probably benign
R4570:Asap3 UTSW 4 136240185 missense probably damaging 0.99
R4879:Asap3 UTSW 4 136242664 missense probably benign 0.04
R5394:Asap3 UTSW 4 136241259 missense probably benign 0.00
R5497:Asap3 UTSW 4 136239222 missense probably benign 0.13
R5914:Asap3 UTSW 4 136241409 missense probably benign 0.18
R6208:Asap3 UTSW 4 136241197 missense probably benign
R6214:Asap3 UTSW 4 136241425 missense possibly damaging 0.80
R6495:Asap3 UTSW 4 136228479 splice site probably null
R6577:Asap3 UTSW 4 136238230 splice site probably null
R6823:Asap3 UTSW 4 136227572 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AAGAGCTGGTGAGTCTGACC -3'
(R):5'- CTCACTTTGGCTCTGAGTGG -3'

Sequencing Primer
(F):5'- CTGGTGAGTCTGACCGGAGAG -3'
(R):5'- TGGCAACGGTCTCATAGGTC -3'
Posted On2015-01-23