Incidental Mutation 'R3704:Raet1e'
ID258658
Institutional Source Beutler Lab
Gene Symbol Raet1e
Ensembl Gene ENSMUSG00000053219
Gene Nameretinoic acid early transcript 1E
SynonymsRae-1 epsilon
MMRRC Submission 040697-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.534) question?
Stock #R3704 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location22158569-22374139 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 22180845 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 107 (T107A)
Ref Sequence ENSEMBL: ENSMUSP00000138022 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065527] [ENSMUST00000105522] [ENSMUST00000178026] [ENSMUST00000180648] [ENSMUST00000181645]
Predicted Effect probably benign
Transcript: ENSMUST00000065527
AA Change: T107A

PolyPhen 2 Score 0.197 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000066627
Gene: ENSMUSG00000053219
AA Change: T107A

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:MHC_I_2 31 202 1e-121 PFAM
low complexity region 209 229 N/A INTRINSIC
transmembrane domain 233 250 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105522
SMART Domains Protein: ENSMUSP00000101161
Gene: ENSMUSG00000075297

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
PDB:4G59|B 29 195 2e-9 PDB
transmembrane domain 211 233 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178026
AA Change: T107A

PolyPhen 2 Score 0.197 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000136032
Gene: ENSMUSG00000053219
AA Change: T107A

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:MHC_I_2 31 202 7.3e-112 PFAM
low complexity region 209 229 N/A INTRINSIC
transmembrane domain 233 250 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000180648
SMART Domains Protein: ENSMUSP00000137946
Gene: ENSMUSG00000053219

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:MHC_I_2 31 66 3.8e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000181645
AA Change: T107A

PolyPhen 2 Score 0.197 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000138022
Gene: ENSMUSG00000053219
AA Change: T107A

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:MHC_I_2 31 202 1e-121 PFAM
low complexity region 209 229 N/A INTRINSIC
transmembrane domain 233 250 N/A INTRINSIC
Meta Mutation Damage Score 0.124 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 91.8%
Validation Efficiency 100% (49/49)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 T C 11: 48,947,976 T595A possibly damaging Het
Akap13 T C 7: 75,666,550 C585R probably damaging Het
Akr1b10 G T 6: 34,394,754 D285Y probably damaging Het
Akr1b10 A G 6: 34,394,755 D257G probably benign Het
Ankrd17 A T 5: 90,243,969 N1838K possibly damaging Het
Asap3 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGAGGAGGA 4: 136,241,241 probably benign Het
Bcap29 T C 12: 31,617,152 H170R probably benign Het
Brwd3 A G X: 108,760,415 probably benign Het
Capn1 T C 19: 6,007,371 E349G probably damaging Het
Cd27 C T 6: 125,233,398 C222Y probably damaging Het
Cdh12 C A 15: 21,583,826 T584K probably damaging Het
Col13a1 A G 10: 61,867,829 probably null Het
Col22a1 T C 15: 71,970,307 T443A probably damaging Het
Crisp3 A G 17: 40,235,957 probably benign Het
Cubn T A 2: 13,350,943 H1826L probably damaging Het
Eci2 A G 13: 34,993,233 probably benign Het
Fat2 A C 11: 55,309,650 F866C probably damaging Het
Fbxl7 C A 15: 26,543,755 G269C probably damaging Het
Hjurp G C 1: 88,277,215 probably benign Het
Ifi35 G A 11: 101,448,604 M1I probably null Het
Jarid2 A G 13: 44,902,355 T308A probably benign Het
Kcnq3 A G 15: 66,021,739 probably null Het
Kcnt2 C T 1: 140,533,968 T819M probably damaging Het
Kifc3 G A 8: 95,104,028 probably benign Het
Mill1 A G 7: 18,263,053 T190A possibly damaging Het
Mosmo A G 7: 120,730,605 I150V probably damaging Het
Nemf C A 12: 69,331,130 D566Y probably damaging Het
Nisch A G 14: 31,176,745 probably benign Het
Olfr888 T A 9: 38,109,003 F106I possibly damaging Het
Paip2 A G 18: 35,610,921 T9A probably benign Het
Pde5a T C 3: 122,779,019 S318P probably benign Het
Plcd1 T C 9: 119,076,209 I145V possibly damaging Het
Prl2c2 C T 13: 13,002,225 R37H probably damaging Het
Reps1 T G 10: 18,107,680 F424V probably damaging Het
Skint6 A T 4: 113,136,472 V401D possibly damaging Het
Srgn T C 10: 62,497,830 D56G probably damaging Het
Tmem63a G A 1: 180,963,114 D446N possibly damaging Het
Ttn A T 2: 76,831,780 probably benign Het
Ugt2b37 A T 5: 87,242,987 F340L possibly damaging Het
Xirp1 T A 9: 120,016,907 Q970L probably benign Het
Zfr2 T G 10: 81,246,079 V493G probably benign Het
Zmat4 A G 8: 23,797,414 R59G probably benign Het
Other mutations in Raet1e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01077:Raet1e APN 10 22181320 missense probably damaging 1.00
IGL02406:Raet1e APN 10 22180636 missense probably damaging 1.00
IGL02484:Raet1e APN 10 22180767 missense probably benign 0.01
R0049:Raet1e UTSW 10 22180862 missense possibly damaging 0.65
R0238:Raet1e UTSW 10 22180862 missense possibly damaging 0.65
R0238:Raet1e UTSW 10 22180862 missense possibly damaging 0.65
R0239:Raet1e UTSW 10 22180862 missense possibly damaging 0.65
R0639:Raet1e UTSW 10 22174375 missense probably damaging 0.99
R0885:Raet1e UTSW 10 22182087 unclassified probably benign
R4764:Raet1e UTSW 10 22181332 missense probably damaging 1.00
R4799:Raet1e UTSW 10 22181300 missense probably damaging 1.00
R5566:Raet1e UTSW 10 22174405 missense probably damaging 1.00
R6034:Raet1e UTSW 10 22182091 makesense probably null
R6034:Raet1e UTSW 10 22182091 makesense probably null
R6077:Raet1e UTSW 10 22181988 missense possibly damaging 0.72
R6238:Raet1e UTSW 10 22180871 missense probably benign 0.01
R6408:Raet1e UTSW 10 22180746 missense probably benign 0.29
R6939:Raet1e UTSW 10 22174357 missense possibly damaging 0.86
R7147:Raet1e UTSW 10 22181280 missense probably benign 0.29
Z1088:Raet1e UTSW 10 22181951 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- ACAGATGCACACTCTCTTAGGTG -3'
(R):5'- ACTCATTGTGTACCCTGTGG -3'

Sequencing Primer
(F):5'- ACACTCTCTTAGGTGCAACTTGAC -3'
(R):5'- TACCCTGTGGCTGCAAGGTAC -3'
Posted On2015-01-23