Incidental Mutation 'R0328:Syt17'
ID25866
Institutional Source Beutler Lab
Gene Symbol Syt17
Ensembl Gene ENSMUSG00000058420
Gene Namesynaptotagmin XVII
SynonymsBk
MMRRC Submission 038537-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0328 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location118380717-118448222 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 118381993 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 369 (Y369H)
Ref Sequence ENSEMBL: ENSMUSP00000145087 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081574] [ENSMUST00000203465] [ENSMUST00000203796]
Predicted Effect probably benign
Transcript: ENSMUST00000081574
AA Change: Y426H

PolyPhen 2 Score 0.275 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000080284
Gene: ENSMUSG00000058420
AA Change: Y426H

DomainStartEndE-ValueType
low complexity region 90 102 N/A INTRINSIC
low complexity region 103 118 N/A INTRINSIC
low complexity region 159 172 N/A INTRINSIC
C2 196 305 7.92e-19 SMART
low complexity region 315 328 N/A INTRINSIC
C2 333 448 2.8e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203465
AA Change: Y425H

PolyPhen 2 Score 0.142 (Sensitivity: 0.92; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000203796
AA Change: Y369H

PolyPhen 2 Score 0.275 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000145087
Gene: ENSMUSG00000058420
AA Change: Y369H

DomainStartEndE-ValueType
low complexity region 33 45 N/A INTRINSIC
low complexity region 46 61 N/A INTRINSIC
low complexity region 102 115 N/A INTRINSIC
C2 139 248 5.2e-21 SMART
low complexity region 258 271 N/A INTRINSIC
C2 276 391 1.9e-21 SMART
Meta Mutation Damage Score 0.082 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.5%
  • 20x: 90.8%
Validation Efficiency 96% (46/48)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A T 2: 68,744,280 H618L possibly damaging Het
Aacs T C 5: 125,516,259 V642A probably benign Het
Alms1 A G 6: 85,610,814 probably null Het
Arhgap39 A G 15: 76,751,952 probably benign Het
Bard1 C T 1: 71,046,762 V595I probably benign Het
Bptf T C 11: 107,047,127 K2713E probably damaging Het
Calhm1 C T 19: 47,141,303 G260D possibly damaging Het
Ccdc154 A C 17: 25,171,805 K643T probably benign Het
Ccl4 T A 11: 83,663,557 S59T probably damaging Het
Cntd1 T C 11: 101,283,433 S73P probably benign Het
Colgalt2 A T 1: 152,473,108 D168V probably damaging Het
Fam117a T C 11: 95,375,626 probably benign Het
Fat1 A G 8: 45,023,790 T1935A probably benign Het
Fbxw21 T A 9: 109,146,585 I248F possibly damaging Het
Fhod3 A T 18: 25,113,600 M1288L probably benign Het
Gm5114 T G 7: 39,408,461 K578T probably damaging Het
Gxylt2 A T 6: 100,750,535 probably benign Het
Helz G T 11: 107,604,348 A383S probably benign Het
Ift172 C A 5: 31,263,851 E968* probably null Het
Itpripl1 T C 2: 127,142,004 N66S possibly damaging Het
Kcnma1 A G 14: 23,373,197 Y686H probably damaging Het
Ndrg1 C A 15: 66,943,159 probably benign Het
Ogdh T C 11: 6,347,216 V545A probably benign Het
Olfr121 A G 17: 37,752,393 I180V possibly damaging Het
P3h3 G A 6: 124,854,306 probably benign Het
Ppme1 A T 7: 100,333,975 probably null Het
Prkag1 T G 15: 98,815,682 D44A probably damaging Het
Prpf39 T C 12: 65,043,371 probably benign Het
Rabep1 C A 11: 70,919,207 R489S probably damaging Het
Scn10a A G 9: 119,694,102 V75A possibly damaging Het
Sema3d T C 5: 12,448,075 L16P possibly damaging Het
Skida1 T C 2: 18,047,186 probably benign Het
Sptbn4 T C 7: 27,364,170 Y2277C probably damaging Het
Syne1 A G 10: 5,348,945 I1047T possibly damaging Het
Tmem131l C T 3: 83,921,931 probably benign Het
Traf3ip2 A T 10: 39,634,673 D314V probably damaging Het
Ttc28 T G 5: 111,284,067 probably benign Het
Ush1c A C 7: 46,225,448 probably benign Het
Utp20 A T 10: 88,767,107 Y1884N possibly damaging Het
Vmn2r112 T A 17: 22,605,270 I502K probably benign Het
Vmn2r60 T C 7: 42,142,320 probably benign Het
Vmn2r63 T C 7: 42,903,275 I852M probably benign Het
Vmn2r9 T A 5: 108,847,539 E414D probably benign Het
Wnt4 A G 4: 137,295,443 T106A probably damaging Het
Zbtb26 A T 2: 37,436,795 N76K possibly damaging Het
Zfhx2 T C 14: 55,071,988 T885A probably benign Het
Other mutations in Syt17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Syt17 APN 7 118434290 missense probably damaging 0.98
IGL01135:Syt17 APN 7 118382047 missense possibly damaging 0.92
IGL01331:Syt17 APN 7 118408166 missense probably damaging 0.99
IGL01610:Syt17 APN 7 118433993 missense possibly damaging 0.90
IGL01776:Syt17 APN 7 118409953 missense probably damaging 0.99
IGL02125:Syt17 APN 7 118409974 missense probably benign 0.01
IGL02819:Syt17 APN 7 118409920 splice site probably benign
H8562:Syt17 UTSW 7 118408069 missense probably benign 0.01
R0127:Syt17 UTSW 7 118409941 missense probably damaging 0.98
R1789:Syt17 UTSW 7 118436838 missense probably benign 0.00
R1872:Syt17 UTSW 7 118408118 missense probably benign 0.00
R1878:Syt17 UTSW 7 118434245 missense probably benign 0.01
R1918:Syt17 UTSW 7 118433985 missense possibly damaging 0.54
R2133:Syt17 UTSW 7 118382047 missense possibly damaging 0.92
R3777:Syt17 UTSW 7 118433957 missense probably damaging 1.00
R4471:Syt17 UTSW 7 118436817 splice site probably null
R4472:Syt17 UTSW 7 118436817 splice site probably null
R4567:Syt17 UTSW 7 118434272 missense probably benign 0.06
R5211:Syt17 UTSW 7 118442403 missense probably benign 0.19
R5905:Syt17 UTSW 7 118436918 missense probably benign 0.10
R6054:Syt17 UTSW 7 118408133 missense possibly damaging 0.91
R6276:Syt17 UTSW 7 118434290 missense probably damaging 0.98
R6332:Syt17 UTSW 7 118434243 missense probably benign 0.00
R7022:Syt17 UTSW 7 118408019 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CATGATCAACTGTCAGCTCGCTCTC -3'
(R):5'- AGCAACAACCCCATGTTTGCCG -3'

Sequencing Primer
(F):5'- ATGTGTGAAAGTATACCTAGATGTGG -3'
(R):5'- CCCATGTTTGCCGCTGAG -3'
Posted On2013-04-16