Incidental Mutation 'R3705:Asap3'
List |< first << previous [record 35 of 686] next >> last >|
ID258694
Institutional Source Beutler Lab
Gene Symbol Asap3
Ensembl Gene ENSMUSG00000036995
Gene NameArfGAP with SH3 domain, ankyrin repeat and PH domain 3
SynonymsUPLC1, 9430088F20Rik, Ddefl1
MMRRC Submission 040698-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.163) question?
Stock #R3705 (G1)
Quality Score217
Status Validated
Chromosome4
Chromosomal Location136206365-136245216 bp(+) (GRCm38)
Type of Mutationsmall insertion (1 aa in frame mutation)
DNA Base Change (assembly) TGAGGAGGAGGAGGAGGA to TGAGGAGGAGGAGGAGGAGGA at 136241241 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000041899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047526]
Predicted Effect probably benign
Transcript: ENSMUST00000047526
SMART Domains Protein: ENSMUSP00000041899
Gene: ENSMUSG00000036995

DomainStartEndE-ValueType
low complexity region 22 29 N/A INTRINSIC
Pfam:BAR_3 32 264 5.5e-20 PFAM
PH 303 396 5.61e-17 SMART
ArfGap 425 547 8.33e-31 SMART
ANK 584 616 4.86e1 SMART
ANK 620 649 3.06e-5 SMART
low complexity region 794 806 N/A INTRINSIC
Meta Mutation Damage Score 0.1156 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a subfamily of ADP-ribosylation factor(Arf) GTPase-activating proteins that contain additional ankyrin repeat and pleckstrin homology domains. The Arf GAP domain of this protein catalyzes the hydrolysis of GTP bound to Arf proteins. The encoded protein promotes cell differentiation and migration and has been implicated in cancer cell invasion. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2009]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T A 3: 36,987,581 C2703S probably damaging Het
9930111J21Rik1 T C 11: 48,947,976 T595A possibly damaging Het
Abca12 T C 1: 71,285,705 D1538G probably damaging Het
Bcap29 T C 12: 31,617,152 H170R probably benign Het
Brwd3 A G X: 108,760,415 probably benign Het
Capn1 T C 19: 6,007,371 E349G probably damaging Het
Cers3 G T 7: 66,786,075 A261S probably benign Het
Csf3r A G 4: 126,032,285 D221G possibly damaging Het
Cubn T A 2: 13,350,943 H1826L probably damaging Het
Dnajc19 A G 3: 34,080,229 probably null Het
Dync1h1 G A 12: 110,640,586 V2566I possibly damaging Het
Ehd1 A G 19: 6,298,300 D436G probably benign Het
Fam133b T C 5: 3,561,034 probably benign Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Gm13084 T C 4: 143,811,775 T209A probably benign Het
Gpnmb T A 6: 49,051,865 I439N possibly damaging Het
Grm1 G A 10: 10,782,729 T339I possibly damaging Het
Gtpbp3 T G 8: 71,492,135 S345A probably benign Het
Hdac4 A G 1: 91,934,694 probably benign Het
Hfm1 A G 5: 106,892,839 probably benign Het
Ift172 A G 5: 31,261,437 probably null Het
Igfn1 T C 1: 135,968,409 N1473S probably benign Het
Jak3 A G 8: 71,681,522 K423E probably damaging Het
Kifc3 G A 8: 95,104,028 probably benign Het
Lrrc8d T C 5: 105,813,475 S584P probably damaging Het
Nipal4 T C 11: 46,161,851 probably benign Het
Nisch A G 14: 31,176,745 probably benign Het
Nmur2 T C 11: 56,040,474 Y137C probably damaging Het
Nod2 T C 8: 88,653,320 S150P probably benign Het
Olfr153 A G 2: 87,532,068 I12V probably benign Het
Pdgfc T C 3: 81,204,444 probably null Het
Phldb1 G T 9: 44,694,394 H1323N probably damaging Het
Ppp1r14c A G 10: 3,423,524 I112V possibly damaging Het
Rcc1l A T 5: 134,154,191 V414E probably damaging Het
Riok3 A G 18: 12,148,954 M327V probably benign Het
Sf3b4 T C 3: 96,176,628 probably benign Het
Spag6 A G 2: 18,710,557 Y49C probably damaging Het
Syngap1 T C 17: 26,960,020 S495P probably damaging Het
Tedc2 A G 17: 24,216,387 S343P probably benign Het
Tenm2 T A 11: 36,068,326 D1132V probably damaging Het
Tmem63a G A 1: 180,963,114 D446N possibly damaging Het
Top1 G A 2: 160,702,824 probably null Het
Tox3 G T 8: 90,248,905 T366K possibly damaging Het
Tph2 G A 10: 115,119,893 Q332* probably null Het
Zfr2 T G 10: 81,246,079 V493G probably benign Het
Other mutations in Asap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00586:Asap3 APN 4 136206568 missense probably damaging 1.00
IGL01865:Asap3 APN 4 136236404 missense probably damaging 1.00
IGL02045:Asap3 APN 4 136227441 missense probably benign 0.01
IGL02105:Asap3 APN 4 136228474 critical splice donor site probably null
IGL02135:Asap3 APN 4 136241153 critical splice acceptor site probably null
IGL02484:Asap3 APN 4 136229457 splice site probably benign
IGL02524:Asap3 APN 4 136238616 missense probably damaging 1.00
IGL02881:Asap3 APN 4 136239237 missense probably benign 0.00
R0128:Asap3 UTSW 4 136234604 missense probably damaging 0.99
R0883:Asap3 UTSW 4 136234325 splice site probably benign
R0903:Asap3 UTSW 4 136238376 missense probably benign
R1073:Asap3 UTSW 4 136236431 missense probably damaging 1.00
R1498:Asap3 UTSW 4 136239194 missense probably benign
R1951:Asap3 UTSW 4 136227456 nonsense probably null
R1953:Asap3 UTSW 4 136227456 nonsense probably null
R3703:Asap3 UTSW 4 136241241 small insertion probably benign
R3704:Asap3 UTSW 4 136241241 small insertion probably benign
R3754:Asap3 UTSW 4 136229455 splice site probably null
R3773:Asap3 UTSW 4 136227575 missense probably benign 0.22
R3911:Asap3 UTSW 4 136229457 splice site probably benign
R4570:Asap3 UTSW 4 136240185 missense probably damaging 0.99
R4879:Asap3 UTSW 4 136242664 missense probably benign 0.04
R5394:Asap3 UTSW 4 136241259 missense probably benign 0.00
R5497:Asap3 UTSW 4 136239222 missense probably benign 0.13
R5914:Asap3 UTSW 4 136241409 missense probably benign 0.18
R6208:Asap3 UTSW 4 136241197 missense probably benign
R6214:Asap3 UTSW 4 136241425 missense possibly damaging 0.80
R6495:Asap3 UTSW 4 136228479 splice site probably null
R6577:Asap3 UTSW 4 136238230 splice site probably null
R6823:Asap3 UTSW 4 136227572 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AAGAGCTGGTGAGTCTGACC -3'
(R):5'- TCCTCACTTTGGCTCTGAGTGG -3'

Sequencing Primer
(F):5'- CTGGTGAGTCTGACCGGAGAG -3'
(R):5'- TGGCAACGGTCTCATAGGTC -3'
Posted On2015-01-23