Incidental Mutation 'R3707:Pappa2'
ID258734
Institutional Source Beutler Lab
Gene Symbol Pappa2
Ensembl Gene ENSMUSG00000073530
Gene Namepappalysin 2
Synonymspregnancy-associated plasma preproprotein-A2, placenta-specific 3, pregnancy-associated plasma protein-E, PAPP-A2, PLAC3, Pappe
MMRRC Submission 040700-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3707 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location158711727-158980490 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 158834918 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 1162 (Y1162*)
Ref Sequence ENSEMBL: ENSMUSP00000124022 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159861]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159860
Predicted Effect probably null
Transcript: ENSMUST00000159861
AA Change: Y1162*
SMART Domains Protein: ENSMUSP00000124022
Gene: ENSMUSG00000073530
AA Change: Y1162*

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Laminin_G_3 271 440 1.2e-25 PFAM
NL 572 614 2.81e-5 SMART
Pfam:Peptidase_M43 669 832 1.5e-12 PFAM
Blast:FN3 844 1103 1e-169 BLAST
low complexity region 1130 1139 N/A INTRINSIC
low complexity region 1361 1370 N/A INTRINSIC
CCP 1394 1457 4.97e0 SMART
CCP 1462 1519 4.81e-1 SMART
CCP 1523 1588 2.58e-4 SMART
CCP 1593 1644 1.13e0 SMART
NL 1720 1757 2.66e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160206
Meta Mutation Damage Score 0.664 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the pappalysin family of metzincin metalloproteinases. The encoded protein cleaves insulin-like growth factor-binding protein 5 and is thought to be a local regulator of insulin-like growth factor (IGF) bioavailability. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for a null mutation are viable and fertile but display postnatal growth retardation that is more pronounced in females compared to males. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
2410089E03Rik T C 15: 8,259,816 S2917P unknown Het
2810474O19Rik C T 6: 149,329,113 S1219L probably damaging Het
Avpr1a T A 10: 122,449,109 F102Y probably damaging Het
Bcs1l A G 1: 74,590,105 probably benign Het
Chrng C T 1: 87,210,611 Q375* probably null Het
Cyp2d10 A G 15: 82,403,016 F469L possibly damaging Het
Dennd6a T C 14: 26,592,391 probably benign Het
Eef2k C A 7: 120,884,712 L224I probably damaging Het
Gm11545 T C 11: 94,757,559 noncoding transcript Het
Herpud1 T A 8: 94,392,239 V207D probably damaging Het
Hmbox1 T C 14: 64,896,836 Y105C probably benign Het
Ighv1-85 A T 12: 116,000,216 W55R probably damaging Het
Lgr4 T C 2: 109,970,754 L83P probably damaging Het
Lrch1 C T 14: 74,857,997 M134I probably damaging Het
Macrod2 C A 2: 141,810,629 T204K probably damaging Het
Mtg1 A T 7: 140,149,804 K269M probably damaging Het
Nkain3 A T 4: 20,484,920 F52L possibly damaging Het
Nr4a3 A T 4: 48,056,699 Y417F probably damaging Het
Olfr1145 T C 2: 87,810,176 C119R probably damaging Het
Olfr767 T A 10: 129,079,385 I193F probably benign Het
Pdhb T C 14: 8,170,409 N114S probably damaging Het
Pigc T A 1: 161,971,094 M215K probably benign Het
Pimreg G A 11: 72,046,332 probably benign Het
Ppfia4 T C 1: 134,309,660 E967G probably damaging Het
Rif1 T A 2: 52,093,580 D578E probably damaging Het
RP23-114B10.6 G C 8: 69,372,416 noncoding transcript Het
Rrbp1 G T 2: 143,953,277 A1269E probably benign Het
Rufy3 G A 5: 88,643,032 A531T probably benign Het
Slc22a22 C A 15: 57,250,973 L319F probably damaging Het
Tapbpl A G 6: 125,224,695 probably null Het
Tdrd1 T C 19: 56,865,993 S1124P possibly damaging Het
Top2a T C 11: 98,996,825 K1286E probably benign Het
Top2b T C 14: 16,388,447 V188A probably damaging Het
Vmn2r4 A T 3: 64,389,474 I630N probably damaging Het
Vmn2r53 T C 7: 12,582,054 T613A possibly damaging Het
Zbtb40 A G 4: 136,999,568 Y486H probably damaging Het
Zfp715 T C 7: 43,311,129 T13A probably benign Het
Zfx A G X: 94,098,807 V36A possibly damaging Het
Other mutations in Pappa2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01097:Pappa2 APN 1 158857148 missense probably damaging 1.00
IGL01394:Pappa2 APN 1 158765104 splice site probably benign
IGL01570:Pappa2 APN 1 158814540 nonsense probably null
IGL01618:Pappa2 APN 1 158857378 missense probably damaging 1.00
IGL01717:Pappa2 APN 1 158857132 critical splice donor site probably null
IGL01804:Pappa2 APN 1 158936519 missense probably benign
IGL01904:Pappa2 APN 1 158783941 missense probably damaging 0.99
IGL02116:Pappa2 APN 1 158845125 missense probably benign 0.01
IGL02174:Pappa2 APN 1 158761618 missense probably damaging 1.00
IGL02302:Pappa2 APN 1 158715001 missense probably benign 0.38
IGL02422:Pappa2 APN 1 158936933 missense probably damaging 1.00
IGL02572:Pappa2 APN 1 158851216 missense probably benign
IGL02659:Pappa2 APN 1 158936794 missense probably damaging 0.97
IGL02887:Pappa2 APN 1 158782259 missense probably damaging 1.00
IGL02981:Pappa2 APN 1 158851144 missense probably benign 0.00
IGL03128:Pappa2 APN 1 158936484 missense probably benign 0.16
IGL03142:Pappa2 APN 1 158854931 missense probably damaging 1.00
IGL03270:Pappa2 APN 1 158765067 missense possibly damaging 0.78
Gulliver UTSW 1 158857136 missense probably null 1.00
Lilliputian UTSW 1 158716990 missense probably damaging 1.00
Lilliputian2 UTSW 1 158834918 nonsense probably null
lilliputian3 UTSW 1 158782403 splice site probably null
Pitzel UTSW 1 158956645 missense probably damaging 1.00
R0106:Pappa2 UTSW 1 158714977 missense probably damaging 1.00
R0106:Pappa2 UTSW 1 158714977 missense probably damaging 1.00
R0172:Pappa2 UTSW 1 158854849 critical splice donor site probably null
R0194:Pappa2 UTSW 1 158765101 splice site probably benign
R0418:Pappa2 UTSW 1 158716990 missense probably damaging 1.00
R0421:Pappa2 UTSW 1 158848080 missense probably damaging 1.00
R0441:Pappa2 UTSW 1 158763058 unclassified probably benign
R0602:Pappa2 UTSW 1 158763055 unclassified probably benign
R0630:Pappa2 UTSW 1 158832773 missense probably benign
R0760:Pappa2 UTSW 1 158716961 critical splice donor site probably null
R1146:Pappa2 UTSW 1 158854982 missense probably damaging 1.00
R1146:Pappa2 UTSW 1 158854982 missense probably damaging 1.00
R1243:Pappa2 UTSW 1 158845100 missense probably damaging 1.00
R1413:Pappa2 UTSW 1 158936554 missense probably benign 0.00
R1502:Pappa2 UTSW 1 158957288 missense probably damaging 1.00
R1599:Pappa2 UTSW 1 158857172 missense probably damaging 1.00
R1689:Pappa2 UTSW 1 158957398 missense probably damaging 1.00
R1750:Pappa2 UTSW 1 158763150 nonsense probably null
R1772:Pappa2 UTSW 1 158814368 missense possibly damaging 0.92
R1832:Pappa2 UTSW 1 158857316 missense probably damaging 1.00
R1905:Pappa2 UTSW 1 158803503 splice site probably null
R1914:Pappa2 UTSW 1 158750563 missense probably damaging 0.97
R2013:Pappa2 UTSW 1 158834928 missense probably damaging 1.00
R2037:Pappa2 UTSW 1 158956644 nonsense probably null
R2118:Pappa2 UTSW 1 158857266 missense probably damaging 1.00
R2268:Pappa2 UTSW 1 158857271 missense probably damaging 1.00
R2269:Pappa2 UTSW 1 158857271 missense probably damaging 1.00
R2347:Pappa2 UTSW 1 158765043 missense probably damaging 1.00
R3024:Pappa2 UTSW 1 158936225 missense probably benign 0.00
R3706:Pappa2 UTSW 1 158834918 nonsense probably null
R3708:Pappa2 UTSW 1 158834918 nonsense probably null
R4600:Pappa2 UTSW 1 158814445 missense probably damaging 1.00
R4737:Pappa2 UTSW 1 158957012 missense probably benign
R4738:Pappa2 UTSW 1 158957012 missense probably benign
R4739:Pappa2 UTSW 1 158957002 missense probably damaging 0.99
R4739:Pappa2 UTSW 1 158957012 missense probably benign
R4788:Pappa2 UTSW 1 158783917 missense possibly damaging 0.86
R4798:Pappa2 UTSW 1 158857379 missense probably damaging 0.99
R4952:Pappa2 UTSW 1 158857136 missense probably null 1.00
R5121:Pappa2 UTSW 1 158838627 missense probably benign 0.01
R5144:Pappa2 UTSW 1 158957133 missense probably benign 0.03
R5159:Pappa2 UTSW 1 158761619 missense probably damaging 1.00
R5278:Pappa2 UTSW 1 158782403 splice site probably null
R5428:Pappa2 UTSW 1 158814785 missense possibly damaging 0.53
R5452:Pappa2 UTSW 1 158838602 missense probably benign 0.00
R5477:Pappa2 UTSW 1 158956738 missense probably benign 0.00
R5504:Pappa2 UTSW 1 158848045 missense probably benign 0.00
R5852:Pappa2 UTSW 1 158717014 missense probably damaging 1.00
R6003:Pappa2 UTSW 1 158936250 missense probably benign 0.23
R6129:Pappa2 UTSW 1 158714997 nonsense probably null
R6137:Pappa2 UTSW 1 158871543 missense probably damaging 1.00
R6374:Pappa2 UTSW 1 158956645 missense probably damaging 1.00
R6472:Pappa2 UTSW 1 158834799 missense probably damaging 1.00
R6804:Pappa2 UTSW 1 158936868 missense probably benign 0.24
R7020:Pappa2 UTSW 1 158848009 missense probably damaging 0.98
R7051:Pappa2 UTSW 1 158957183 missense unknown
R7082:Pappa2 UTSW 1 158763119 missense possibly damaging 0.65
R7111:Pappa2 UTSW 1 158956526 missense probably benign 0.38
R7213:Pappa2 UTSW 1 158936886 missense possibly damaging 0.93
X0058:Pappa2 UTSW 1 158814397 missense probably null
X0061:Pappa2 UTSW 1 158936618 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- AGCCATGACTCCATTCTTCTGG -3'
(R):5'- TGCTTCTTCCCTCATAAAGAGTG -3'

Sequencing Primer
(F):5'- CTGGCTTAACTTACCATTGAATGAGG -3'
(R):5'- TCTTCCCTCATAAAGAGTGAAAAAC -3'
Posted On2015-01-23