Incidental Mutation 'R3707:Dennd6a'
ID258762
Institutional Source Beutler Lab
Gene Symbol Dennd6a
Ensembl Gene ENSMUSG00000040818
Gene NameDENN/MADD domain containing 6A
SynonymsA630054L15Rik, Fam116a
MMRRC Submission 040700-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.216) question?
Stock #R3707 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location26573856-26634322 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 26592391 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153200 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037585] [ENSMUST00000203874] [ENSMUST00000224111] [ENSMUST00000224248] [ENSMUST00000224378]
Predicted Effect probably benign
Transcript: ENSMUST00000037585
SMART Domains Protein: ENSMUSP00000039361
Gene: ENSMUSG00000040818

DomainStartEndE-ValueType
low complexity region 17 51 N/A INTRINSIC
Pfam:Avl9 59 200 2.9e-11 PFAM
Pfam:DENN 165 371 1.1e-7 PFAM
Pfam:SPA 265 373 4.2e-18 PFAM
low complexity region 379 390 N/A INTRINSIC
low complexity region 412 423 N/A INTRINSIC
low complexity region 526 541 N/A INTRINSIC
low complexity region 554 563 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203874
SMART Domains Protein: ENSMUSP00000144906
Gene: ENSMUSG00000040818

DomainStartEndE-ValueType
low complexity region 17 51 N/A INTRINSIC
Pfam:Avl9 59 200 2.6e-11 PFAM
Pfam:DENN 165 371 9.7e-8 PFAM
Pfam:SPA 265 373 3.7e-18 PFAM
low complexity region 379 390 N/A INTRINSIC
low complexity region 412 423 N/A INTRINSIC
low complexity region 526 537 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000224111
Predicted Effect probably benign
Transcript: ENSMUST00000224248
Predicted Effect probably benign
Transcript: ENSMUST00000224378
Meta Mutation Damage Score 0.1124 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 97% (37/38)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
2410089E03Rik T C 15: 8,259,816 S2917P unknown Het
2810474O19Rik C T 6: 149,329,113 S1219L probably damaging Het
Avpr1a T A 10: 122,449,109 F102Y probably damaging Het
Bcs1l A G 1: 74,590,105 probably benign Het
Chrng C T 1: 87,210,611 Q375* probably null Het
Cyp2d10 A G 15: 82,403,016 F469L possibly damaging Het
Eef2k C A 7: 120,884,712 L224I probably damaging Het
Gm11545 T C 11: 94,757,559 noncoding transcript Het
Herpud1 T A 8: 94,392,239 V207D probably damaging Het
Hmbox1 T C 14: 64,896,836 Y105C probably benign Het
Ighv1-85 A T 12: 116,000,216 W55R probably damaging Het
Lgr4 T C 2: 109,970,754 L83P probably damaging Het
Lrch1 C T 14: 74,857,997 M134I probably damaging Het
Macrod2 C A 2: 141,810,629 T204K probably damaging Het
Mtg1 A T 7: 140,149,804 K269M probably damaging Het
Nkain3 A T 4: 20,484,920 F52L possibly damaging Het
Nr4a3 A T 4: 48,056,699 Y417F probably damaging Het
Olfr1145 T C 2: 87,810,176 C119R probably damaging Het
Olfr767 T A 10: 129,079,385 I193F probably benign Het
Pappa2 A T 1: 158,834,918 Y1162* probably null Het
Pdhb T C 14: 8,170,409 N114S probably damaging Het
Pigc T A 1: 161,971,094 M215K probably benign Het
Pimreg G A 11: 72,046,332 probably benign Het
Ppfia4 T C 1: 134,309,660 E967G probably damaging Het
Rif1 T A 2: 52,093,580 D578E probably damaging Het
RP23-114B10.6 G C 8: 69,372,416 noncoding transcript Het
Rrbp1 G T 2: 143,953,277 A1269E probably benign Het
Rufy3 G A 5: 88,643,032 A531T probably benign Het
Slc22a22 C A 15: 57,250,973 L319F probably damaging Het
Tapbpl A G 6: 125,224,695 probably null Het
Tdrd1 T C 19: 56,865,993 S1124P possibly damaging Het
Top2a T C 11: 98,996,825 K1286E probably benign Het
Top2b T C 14: 16,388,447 V188A probably damaging Het
Vmn2r4 A T 3: 64,389,474 I630N probably damaging Het
Vmn2r53 T C 7: 12,582,054 T613A possibly damaging Het
Zbtb40 A G 4: 136,999,568 Y486H probably damaging Het
Zfp715 T C 7: 43,311,129 T13A probably benign Het
Zfx A G X: 94,098,807 V36A possibly damaging Het
Other mutations in Dennd6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Dennd6a APN 14 26608613 missense probably damaging 1.00
IGL01011:Dennd6a APN 14 26603054 missense probably damaging 0.99
IGL01395:Dennd6a APN 14 26616901 nonsense probably null
IGL01559:Dennd6a APN 14 26608565 missense probably damaging 1.00
IGL01590:Dennd6a APN 14 26619352 missense probably benign 0.40
IGL02187:Dennd6a APN 14 26606926 missense probably benign
IGL03296:Dennd6a APN 14 26616960 critical splice donor site probably null
R1831:Dennd6a UTSW 14 26606954 missense probably damaging 1.00
R1833:Dennd6a UTSW 14 26606954 missense probably damaging 1.00
R2020:Dennd6a UTSW 14 26612003 missense probably damaging 0.99
R2032:Dennd6a UTSW 14 26604749 missense probably benign 0.42
R2036:Dennd6a UTSW 14 26608119 missense probably damaging 0.99
R4112:Dennd6a UTSW 14 26628518 intron probably benign
R4728:Dennd6a UTSW 14 26627420 missense probably null 1.00
R5053:Dennd6a UTSW 14 26608583 missense probably damaging 1.00
R5760:Dennd6a UTSW 14 26612040 missense probably damaging 0.99
R5774:Dennd6a UTSW 14 26579819 missense probably benign
R5775:Dennd6a UTSW 14 26619373 nonsense probably null
R6238:Dennd6a UTSW 14 26616658 critical splice donor site probably null
R6446:Dennd6a UTSW 14 26629534 missense probably damaging 1.00
R6734:Dennd6a UTSW 14 26608619 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- ACTAGAATTTTCGGCATACCCAC -3'
(R):5'- CAGAATCAATGAAGTGCTGAGC -3'

Sequencing Primer
(F):5'- GAATTTTCGGCATACCCACTATATG -3'
(R):5'- TGAGCTAAAACTGAGCATGCC -3'
Posted On2015-01-23