Incidental Mutation 'R3707:Hmbox1'
ID258763
Institutional Source Beutler Lab
Gene Symbol Hmbox1
Ensembl Gene ENSMUSG00000021972
Gene Namehomeobox containing 1
SynonymsF830020C16Rik
MMRRC Submission 040700-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.668) question?
Stock #R3707 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location64811600-64949871 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 64896836 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 105 (Y105C)
Ref Sequence ENSEMBL: ENSMUSP00000135211 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022544] [ENSMUST00000067843] [ENSMUST00000175744] [ENSMUST00000175905] [ENSMUST00000176128] [ENSMUST00000176489] [ENSMUST00000176832]
Predicted Effect probably benign
Transcript: ENSMUST00000022544
AA Change: Y105C

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000022544
Gene: ENSMUSG00000021972
AA Change: Y105C

DomainStartEndE-ValueType
Pfam:HNF-1_N 19 231 2.3e-15 PFAM
HOX 267 344 6.18e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000067843
AA Change: Y105C

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000066905
Gene: ENSMUSG00000021972
AA Change: Y105C

DomainStartEndE-ValueType
Pfam:HNF-1_N 19 231 2.5e-15 PFAM
HOX 267 344 8.74e-9 SMART
low complexity region 372 385 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175744
AA Change: Y105C

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000135272
Gene: ENSMUSG00000021972
AA Change: Y105C

DomainStartEndE-ValueType
Pfam:HNF-1_N 19 231 1.4e-15 PFAM
HOX 267 344 8.74e-9 SMART
low complexity region 382 404 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175905
AA Change: Y105C

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000135657
Gene: ENSMUSG00000021972
AA Change: Y105C

DomainStartEndE-ValueType
Pfam:HNF-1_N 19 231 1.5e-15 PFAM
HOX 267 344 6.18e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176128
AA Change: Y105C

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000135448
Gene: ENSMUSG00000021972
AA Change: Y105C

DomainStartEndE-ValueType
Pfam:HNF-1_N 25 227 4.4e-66 PFAM
HOX 267 344 6.18e-9 SMART
low complexity region 373 386 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176489
AA Change: Y105C

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000134824
Gene: ENSMUSG00000021972
AA Change: Y105C

DomainStartEndE-ValueType
Pfam:HNF-1_N 19 231 1.1e-15 PFAM
HOX 267 355 1.89e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176657
Predicted Effect probably benign
Transcript: ENSMUST00000176832
AA Change: Y105C

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000135211
Gene: ENSMUSG00000021972
AA Change: Y105C

DomainStartEndE-ValueType
Pfam:HNF-1_N 19 231 1.4e-15 PFAM
HOX 267 344 8.74e-9 SMART
Predicted Effect unknown
Transcript: ENSMUST00000177326
AA Change: Y106C
Meta Mutation Damage Score 0.248 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 97% (37/38)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele exhibit absence of TERT binding to chromatin as shown by subcellular fractionation analysis of mouse embryonic fibroblasts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
2410089E03Rik T C 15: 8,259,816 S2917P unknown Het
2810474O19Rik C T 6: 149,329,113 S1219L probably damaging Het
Avpr1a T A 10: 122,449,109 F102Y probably damaging Het
Bcs1l A G 1: 74,590,105 probably benign Het
Chrng C T 1: 87,210,611 Q375* probably null Het
Cyp2d10 A G 15: 82,403,016 F469L possibly damaging Het
Dennd6a T C 14: 26,592,391 probably benign Het
Eef2k C A 7: 120,884,712 L224I probably damaging Het
Gm11545 T C 11: 94,757,559 noncoding transcript Het
Herpud1 T A 8: 94,392,239 V207D probably damaging Het
Ighv1-85 A T 12: 116,000,216 W55R probably damaging Het
Lgr4 T C 2: 109,970,754 L83P probably damaging Het
Lrch1 C T 14: 74,857,997 M134I probably damaging Het
Macrod2 C A 2: 141,810,629 T204K probably damaging Het
Mtg1 A T 7: 140,149,804 K269M probably damaging Het
Nkain3 A T 4: 20,484,920 F52L possibly damaging Het
Nr4a3 A T 4: 48,056,699 Y417F probably damaging Het
Olfr1145 T C 2: 87,810,176 C119R probably damaging Het
Olfr767 T A 10: 129,079,385 I193F probably benign Het
Pappa2 A T 1: 158,834,918 Y1162* probably null Het
Pdhb T C 14: 8,170,409 N114S probably damaging Het
Pigc T A 1: 161,971,094 M215K probably benign Het
Pimreg G A 11: 72,046,332 probably benign Het
Ppfia4 T C 1: 134,309,660 E967G probably damaging Het
Rif1 T A 2: 52,093,580 D578E probably damaging Het
RP23-114B10.6 G C 8: 69,372,416 noncoding transcript Het
Rrbp1 G T 2: 143,953,277 A1269E probably benign Het
Rufy3 G A 5: 88,643,032 A531T probably benign Het
Slc22a22 C A 15: 57,250,973 L319F probably damaging Het
Tapbpl A G 6: 125,224,695 probably null Het
Tdrd1 T C 19: 56,865,993 S1124P possibly damaging Het
Top2a T C 11: 98,996,825 K1286E probably benign Het
Top2b T C 14: 16,388,447 V188A probably damaging Het
Vmn2r4 A T 3: 64,389,474 I630N probably damaging Het
Vmn2r53 T C 7: 12,582,054 T613A possibly damaging Het
Zbtb40 A G 4: 136,999,568 Y486H probably damaging Het
Zfp715 T C 7: 43,311,129 T13A probably benign Het
Zfx A G X: 94,098,807 V36A possibly damaging Het
Other mutations in Hmbox1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03183:Hmbox1 APN 14 64887599 missense probably damaging 1.00
R0962:Hmbox1 UTSW 14 64896774 missense probably benign 0.00
R1144:Hmbox1 UTSW 14 64825683 missense probably damaging 1.00
R1467:Hmbox1 UTSW 14 64861578 missense possibly damaging 0.90
R1467:Hmbox1 UTSW 14 64861578 missense possibly damaging 0.90
R1856:Hmbox1 UTSW 14 64828648 missense probably damaging 1.00
R2101:Hmbox1 UTSW 14 64828579 splice site probably benign
R4531:Hmbox1 UTSW 14 64825489 missense probably benign
R4570:Hmbox1 UTSW 14 64823662 missense possibly damaging 0.95
R4572:Hmbox1 UTSW 14 64903233 splice site probably null
R4740:Hmbox1 UTSW 14 64897034 missense probably damaging 1.00
R4807:Hmbox1 UTSW 14 64825549 intron probably benign
R5112:Hmbox1 UTSW 14 64825612 missense probably damaging 1.00
R5327:Hmbox1 UTSW 14 64896695 missense possibly damaging 0.77
R5575:Hmbox1 UTSW 14 64823164 missense probably benign
R5928:Hmbox1 UTSW 14 64823673 missense possibly damaging 0.55
R6934:Hmbox1 UTSW 14 64896832 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- AGTCTTAGAAAATATACATGCCTGGGG -3'
(R):5'- ACTTTGGACCGTCTTGATCAAG -3'

Sequencing Primer
(F):5'- GGGGGATTCTGAATAGACAACATAC -3'
(R):5'- CCGTCTTGATCAAGAGCATAGTG -3'
Posted On2015-01-23