Incidental Mutation 'R3719:Cdk11b'
ID258812
Institutional Source Beutler Lab
Gene Symbol Cdk11b
Ensembl Gene ENSMUSG00000029062
Gene Namecyclin-dependent kinase 11B
SynonymsPITSLRE proteins, CDK11-p110, Cdc2l1, Cdc2l2, CDK11-p46, CDK11-p58
MMRRC Submission 042001-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3719 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location155624854-155649938 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 155626886 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 75 (D75G)
Ref Sequence ENSEMBL: ENSMUSP00000101225 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067081] [ENSMUST00000105598] [ENSMUST00000105600] [ENSMUST00000105608] [ENSMUST00000115821]
Predicted Effect probably damaging
Transcript: ENSMUST00000067081
AA Change: D75G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000070527
Gene: ENSMUSG00000029062
AA Change: D75G

DomainStartEndE-ValueType
low complexity region 19 48 N/A INTRINSIC
low complexity region 93 112 N/A INTRINSIC
coiled coil region 123 214 N/A INTRINSIC
low complexity region 252 259 N/A INTRINSIC
low complexity region 261 272 N/A INTRINSIC
coiled coil region 290 337 N/A INTRINSIC
low complexity region 369 383 N/A INTRINSIC
S_TKc 427 712 5.05e-93 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105598
AA Change: D41G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101223
Gene: ENSMUSG00000029062
AA Change: D41G

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 59 78 N/A INTRINSIC
coiled coil region 89 180 N/A INTRINSIC
low complexity region 218 225 N/A INTRINSIC
low complexity region 227 238 N/A INTRINSIC
coiled coil region 256 303 N/A INTRINSIC
low complexity region 335 349 N/A INTRINSIC
S_TKc 393 678 5.05e-93 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105600
AA Change: D75G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101225
Gene: ENSMUSG00000029062
AA Change: D75G

DomainStartEndE-ValueType
low complexity region 19 48 N/A INTRINSIC
low complexity region 93 112 N/A INTRINSIC
coiled coil region 123 214 N/A INTRINSIC
low complexity region 252 259 N/A INTRINSIC
low complexity region 261 272 N/A INTRINSIC
coiled coil region 290 337 N/A INTRINSIC
low complexity region 369 383 N/A INTRINSIC
S_TKc 427 712 5.05e-93 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105608
SMART Domains Protein: ENSMUSP00000101233
Gene: ENSMUSG00000042202

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
low complexity region 50 66 N/A INTRINSIC
Pfam:UAA 75 375 6.9e-10 PFAM
Pfam:EamA 84 215 5.8e-8 PFAM
Pfam:TPT 224 369 3.8e-34 PFAM
Pfam:EamA 237 369 3.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115821
SMART Domains Protein: ENSMUSP00000111488
Gene: ENSMUSG00000073682

DomainStartEndE-ValueType
SCOP:d1l9ha_ 17 52 2e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135550
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137752
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149498
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154931
Meta Mutation Damage Score 0.16 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine/threonine protein kinase family. Members of this kinase family are known to be essential for eukaryotic cell cycle control. Due to a segmental duplication, this gene shares very high sequence identity with a neighboring gene. These two genes are frequently deleted or altered in neuroblastoma. The protein kinase encoded by this gene can be cleaved by caspases and may play a role in cell apoptosis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null embryos display embryonic lethality from cell cycle arrest. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts20 G A 15: 94,361,838 R327C probably damaging Het
Atxn2l G A 7: 126,498,130 R335W probably damaging Het
Blk A G 14: 63,384,002 S93P probably damaging Het
Chpf2 C T 5: 24,590,312 Q278* probably null Het
Cypt14 C T X: 39,863,251 G52E probably damaging Het
Defb18 A G 1: 18,236,589 S48P possibly damaging Het
Dync2h1 A G 9: 7,006,882 probably benign Het
Ero1lb T G 13: 12,583,612 probably null Het
Gcn1l1 T C 5: 115,579,817 S254P probably benign Het
Hivep1 T C 13: 42,157,727 S1148P probably benign Het
Kdm3b C T 18: 34,808,671 A405V probably damaging Het
Mcm7 G A 5: 138,166,714 Q550* probably null Het
Olfr1154 G A 2: 87,903,103 T191I probably benign Het
Pcdh7 A G 5: 58,129,032 E1150G probably damaging Het
Pcdhac2 A G 18: 37,146,235 Y756C possibly damaging Het
Pclo A G 5: 14,521,161 T187A probably benign Het
Rbms3 C T 9: 116,582,862 V421I probably benign Het
Selenbp2 T C 3: 94,699,617 F190S probably damaging Het
Sema6a G A 18: 47,249,077 T801M probably damaging Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Spen G T 4: 141,517,183 H180Q unknown Het
Tenm4 A G 7: 96,863,563 K1339R possibly damaging Het
Trim30a C A 7: 104,411,163 D469Y probably benign Het
Trpm3 G A 19: 22,986,990 R1283H possibly damaging Het
Trpm6 A T 19: 18,772,393 R29* probably null Het
Ttc17 A G 2: 94,364,327 V567A probably benign Het
Vmn2r101 A G 17: 19,589,549 Y199C possibly damaging Het
Vmn2r73 A T 7: 85,870,374 Y459N probably damaging Het
Vmn2r79 A G 7: 87,002,037 I215V probably benign Het
Wdr48 C T 9: 119,907,131 S162F probably damaging Het
Other mutations in Cdk11b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01764:Cdk11b APN 4 155628803 missense possibly damaging 0.54
R0071:Cdk11b UTSW 4 155649423 unclassified probably benign
R0071:Cdk11b UTSW 4 155649423 unclassified probably benign
R0145:Cdk11b UTSW 4 155641619 intron probably benign
R0372:Cdk11b UTSW 4 155641500 intron probably benign
R0426:Cdk11b UTSW 4 155642512 intron probably benign
R0471:Cdk11b UTSW 4 155647542 unclassified probably benign
R0627:Cdk11b UTSW 4 155640772 intron probably benign
R1475:Cdk11b UTSW 4 155634217 missense probably damaging 1.00
R1611:Cdk11b UTSW 4 155641575 intron probably benign
R1719:Cdk11b UTSW 4 155648397 unclassified probably benign
R1750:Cdk11b UTSW 4 155628680 intron probably null
R2061:Cdk11b UTSW 4 155641604 intron probably benign
R2274:Cdk11b UTSW 4 155647594 unclassified probably benign
R2922:Cdk11b UTSW 4 155640744 intron probably benign
R3917:Cdk11b UTSW 4 155626801 missense probably damaging 1.00
R4077:Cdk11b UTSW 4 155639747 intron probably benign
R4078:Cdk11b UTSW 4 155639747 intron probably benign
R5033:Cdk11b UTSW 4 155648825 unclassified probably benign
R5212:Cdk11b UTSW 4 155638615 intron probably null
R5556:Cdk11b UTSW 4 155634147 nonsense probably null
R5622:Cdk11b UTSW 4 155630217 missense probably damaging 1.00
R5927:Cdk11b UTSW 4 155648240 unclassified probably benign
R5975:Cdk11b UTSW 4 155648240 unclassified probably benign
R6276:Cdk11b UTSW 4 155634190 missense probably benign 0.11
R6278:Cdk11b UTSW 4 155649603 unclassified probably benign
R6905:Cdk11b UTSW 4 155641608 intron probably benign
R6998:Cdk11b UTSW 4 155648343 nonsense probably null
R7021:Cdk11b UTSW 4 155641567 intron probably benign
R7062:Cdk11b UTSW 4 155626811 missense probably damaging 1.00
R7100:Cdk11b UTSW 4 155625593 missense probably damaging 1.00
Z1088:Cdk11b UTSW 4 155641564 intron probably benign
Predicted Primers PCR Primer
(F):5'- AGACGGAGGCAGGTTTCTAG -3'
(R):5'- GTGGATAAAGTAACACCCACGTAC -3'

Sequencing Primer
(F):5'- GGCAGGTTTCTAGCTCAAAAACCG -3'
(R):5'- TAAAGTAACACCCACGTACACCCC -3'
Posted On2015-01-23