Mutagenetix > Incidental Mutations

Incidental Mutation 'R3719:Trpm6'

258835

Institutional Source

Beutler Lab

Gene Symbol

Trpm6

Ensembl Gene

ENSMUSG00000024727

Gene Name

transient receptor potential cation channel, subfamily M, member 6

Synonyms

CHAK2

MMRRC Submission

042001-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R3719 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

18749983-18892510 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 18772393 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Stop codon at position 29 (R29*)

Ref Sequence

ENSEMBL: ENSMUSP00000037443 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040489]

Predicted Effect

probably null
Transcript: ENSMUST00000040489
AA Change: R29*

SMART Domains

Protein: ENSMUSP00000037443
Gene: ENSMUSG00000024727
AA Change: R29*

Domain	Start	End	E-Value	Type
Blast:ANK	430	459	4e-8	BLAST
low complexity region	580	604	N/A	INTRINSIC
transmembrane domain	749	766	N/A	INTRINSIC
Pfam:Ion_trans	847	1087	2.8e-13	PFAM
low complexity region	1113	1126	N/A	INTRINSIC
low complexity region	1136	1154	N/A	INTRINSIC
Pfam:TRPM_tetra	1176	1231	7.5e-27	PFAM
low complexity region	1320	1331	N/A	INTRINSIC
low complexity region	1578	1596	N/A	INTRINSIC
Blast:Alpha_kinase	1618	1673	9e-11	BLAST
low complexity region	1682	1695	N/A	INTRINSIC
Alpha_kinase	1761	1978	1e-84	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000157976

Meta Mutation Damage Score

0.58

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.2%
20x: 94.7%

Validation Efficiency

97% (35/36)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is predominantly expressed in the kidney and colon, and encodes a protein containing an ion channel domain and a protein kinase domain. It is crucial for magnesium homeostasis, and plays an essential role in epithelial magnesium transport and in the active magnesium absorption in the gut and kidney. Mutations in this gene are associated with hypomagnesemia with secondary hypocalcemia. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic and postnatal lethality with exencephaly, spina bifida occulta, and abnormal brain and facial development. Mice heterozygous for a knock-out allele exhibit some premature death and decreased serummagnesium. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts20	G	A	15: 94,361,838	R327C	probably damaging	Het
Atxn2l	G	A	7: 126,498,130	R335W	probably damaging	Het
Blk	A	G	14: 63,384,002	S93P	probably damaging	Het
Cdk11b	A	G	4: 155,626,886	D75G	probably damaging	Het
Chpf2	C	T	5: 24,590,312	Q278*	probably null	Het
Cypt14	C	T	X: 39,863,251	G52E	probably damaging	Het
Defb18	A	G	1: 18,236,589	S48P	possibly damaging	Het
Dync2h1	A	G	9: 7,006,882		probably benign	Het
Ero1lb	T	G	13: 12,583,612		probably null	Het
Gcn1l1	T	C	5: 115,579,817	S254P	probably benign	Het
Hivep1	T	C	13: 42,157,727	S1148P	probably benign	Het
Kdm3b	C	T	18: 34,808,671	A405V	probably damaging	Het
Mcm7	G	A	5: 138,166,714	Q550*	probably null	Het
Olfr1154	G	A	2: 87,903,103	T191I	probably benign	Het
Pcdh7	A	G	5: 58,129,032	E1150G	probably damaging	Het
Pcdhac2	A	G	18: 37,146,235	Y756C	possibly damaging	Het
Pclo	A	G	5: 14,521,161	T187A	probably benign	Het
Rbms3	C	T	9: 116,582,862	V421I	probably benign	Het
Selenbp2	T	C	3: 94,699,617	F190S	probably damaging	Het
Sema6a	G	A	18: 47,249,077	T801M	probably damaging	Het
Slc16a10	G	C	10: 40,056,624	H314D	possibly damaging	Het
Spen	G	T	4: 141,517,183	H180Q	unknown	Het
Tenm4	A	G	7: 96,863,563	K1339R	possibly damaging	Het
Trim30a	C	A	7: 104,411,163	D469Y	probably benign	Het
Trpm3	G	A	19: 22,986,990	R1283H	possibly damaging	Het
Ttc17	A	G	2: 94,364,327	V567A	probably benign	Het
Vmn2r101	A	G	17: 19,589,549	Y199C	possibly damaging	Het
Vmn2r73	A	T	7: 85,870,374	Y459N	probably damaging	Het
Vmn2r79	A	G	7: 87,002,037	I215V	probably benign	Het
Wdr48	C	T	9: 119,907,131	S162F	probably damaging	Het

Other mutations in Trpm6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00540:Trpm6	APN	19	18783908	splice site	probably benign
IGL00862:Trpm6	APN	19	18827528	missense	probably damaging	1.00
IGL01348:Trpm6	APN	19	18877651	missense	probably damaging	1.00
IGL01400:Trpm6	APN	19	18825794	nonsense	probably null
IGL01451:Trpm6	APN	19	18809569	missense	probably damaging	1.00
IGL01508:Trpm6	APN	19	18796530	nonsense	probably null
IGL01995:Trpm6	APN	19	18830327	splice site	probably benign
IGL02092:Trpm6	APN	19	18772331	missense	possibly damaging	0.59
IGL02152:Trpm6	APN	19	18832539	missense	possibly damaging	0.93
IGL02294:Trpm6	APN	19	18854063	missense	probably benign
IGL02329:Trpm6	APN	19	18854217	missense	probably benign	0.17
IGL02366:Trpm6	APN	19	18778510	splice site	probably benign
IGL02402:Trpm6	APN	19	18786756	missense	probably benign	0.18
IGL02457:Trpm6	APN	19	18825791	missense	probably damaging	1.00
IGL02457:Trpm6	APN	19	18827398	nonsense	probably null
IGL02684:Trpm6	APN	19	18802207	splice site	probably benign
IGL02705:Trpm6	APN	19	18776733	critical splice donor site	probably null
IGL02728:Trpm6	APN	19	18809652	missense	possibly damaging	0.71
IGL02742:Trpm6	APN	19	18830012	splice site	probably benign
IGL02818:Trpm6	APN	19	18866257	missense	probably benign	0.04
IGL02836:Trpm6	APN	19	18813482	missense	probably damaging	1.00
IGL03119:Trpm6	APN	19	18838017	nonsense	probably null
IGL03193:Trpm6	APN	19	18825872	missense	possibly damaging	0.94
IGL03227:Trpm6	APN	19	18819119	missense	probably benign	0.01
IGL03227:Trpm6	APN	19	18786779	missense	probably benign	0.12
IGL03231:Trpm6	APN	19	18819181	missense	probably benign
IGL03245:Trpm6	APN	19	18877701	missense	probably damaging	1.00
IGL03328:Trpm6	APN	19	18838082	missense	possibly damaging	0.94
IGL03341:Trpm6	APN	19	18813486	missense	probably benign
P0043:Trpm6	UTSW	19	18877765	missense	probably damaging	1.00
R0057:Trpm6	UTSW	19	18786755	missense	probably benign	0.05
R0115:Trpm6	UTSW	19	18829952	missense	probably damaging	0.98
R0119:Trpm6	UTSW	19	18832593	missense	probably benign	0.05
R0140:Trpm6	UTSW	19	18819194	splice site	probably null
R0267:Trpm6	UTSW	19	18823378	missense	probably benign
R0350:Trpm6	UTSW	19	18883957	splice site	probably null
R0373:Trpm6	UTSW	19	18853587	missense	probably benign	0.15
R0393:Trpm6	UTSW	19	18778644	missense	probably damaging	0.99
R0416:Trpm6	UTSW	19	18783025	splice site	probably benign
R0505:Trpm6	UTSW	19	18873902	splice site	probably benign
R0526:Trpm6	UTSW	19	18792876	missense	probably damaging	0.97
R0607:Trpm6	UTSW	19	18872221	missense	probably benign	0.00
R0609:Trpm6	UTSW	19	18825862	missense	probably damaging	0.97
R0714:Trpm6	UTSW	19	18838087	missense	possibly damaging	0.90
R1215:Trpm6	UTSW	19	18796498	missense	probably damaging	1.00
R1474:Trpm6	UTSW	19	18796495	missense	probably benign	0.28
R1512:Trpm6	UTSW	19	18875931	missense	probably benign
R1558:Trpm6	UTSW	19	18786828	missense	probably benign	0.04
R1597:Trpm6	UTSW	19	18827524	missense	probably damaging	0.98
R1618:Trpm6	UTSW	19	18877631	missense	possibly damaging	0.88
R1779:Trpm6	UTSW	19	18856217	missense	probably damaging	1.00
R1796:Trpm6	UTSW	19	18827567	missense	possibly damaging	0.90
R1799:Trpm6	UTSW	19	18891999	splice site	probably null
R1840:Trpm6	UTSW	19	18866267	missense	probably benign	0.21
R1991:Trpm6	UTSW	19	18796284	missense	probably benign	0.00
R2030:Trpm6	UTSW	19	18854265	missense	probably benign
R2073:Trpm6	UTSW	19	18876042	missense	probably damaging	1.00
R2074:Trpm6	UTSW	19	18877739	missense	probably damaging	1.00
R2096:Trpm6	UTSW	19	18825752	missense	probably damaging	0.97
R2103:Trpm6	UTSW	19	18796284	missense	probably benign	0.00
R2106:Trpm6	UTSW	19	18813350	missense	possibly damaging	0.95
R2117:Trpm6	UTSW	19	18829952	missense	probably damaging	0.98
R2850:Trpm6	UTSW	19	18792090	missense	possibly damaging	0.68
R3125:Trpm6	UTSW	19	18854431	missense	probably benign	0.05
R3779:Trpm6	UTSW	19	18876039	missense	possibly damaging	0.80
R4115:Trpm6	UTSW	19	18832557	missense	probably damaging	1.00
R4367:Trpm6	UTSW	19	18827525	missense	probably damaging	0.99
R4523:Trpm6	UTSW	19	18796500	missense	probably damaging	1.00
R4546:Trpm6	UTSW	19	18832477	missense	probably damaging	1.00
R4564:Trpm6	UTSW	19	18832597	missense	possibly damaging	0.95
R4565:Trpm6	UTSW	19	18825872	missense	probably damaging	1.00
R4697:Trpm6	UTSW	19	18853791	missense	probably benign	0.01
R4714:Trpm6	UTSW	19	18854200	missense	possibly damaging	0.93
R4750:Trpm6	UTSW	19	18876064	missense	probably damaging	0.99
R4771:Trpm6	UTSW	19	18813493	missense	probably damaging	0.97
R4791:Trpm6	UTSW	19	18867981	missense	probably benign	0.00
R4814:Trpm6	UTSW	19	18862212	missense	probably benign	0.11
R5028:Trpm6	UTSW	19	18786760	missense	probably damaging	1.00
R5237:Trpm6	UTSW	19	18813464	missense	probably damaging	1.00
R5615:Trpm6	UTSW	19	18829933	missense	probably damaging	0.96
R5642:Trpm6	UTSW	19	18830207	missense	probably damaging	1.00
R5645:Trpm6	UTSW	19	18853604	missense	probably damaging	1.00
R5726:Trpm6	UTSW	19	18853617	missense	probably damaging	1.00
R5832:Trpm6	UTSW	19	18786819	missense	possibly damaging	0.66
R5843:Trpm6	UTSW	19	18856175	missense	probably benign	0.04
R5955:Trpm6	UTSW	19	18892019	missense	possibly damaging	0.75
R6101:Trpm6	UTSW	19	18853748	nonsense	probably null
R6105:Trpm6	UTSW	19	18853748	nonsense	probably null
R6211:Trpm6	UTSW	19	18783128	missense	probably damaging	1.00
R6228:Trpm6	UTSW	19	18854291	missense	probably damaging	1.00
R6263:Trpm6	UTSW	19	18854108	missense	possibly damaging	0.94
R6453:Trpm6	UTSW	19	18829990	missense	probably damaging	1.00
R6562:Trpm6	UTSW	19	18838042	missense	probably damaging	1.00
R6624:Trpm6	UTSW	19	18796439	critical splice acceptor site	probably null
R6624:Trpm6	UTSW	19	18889020	missense	probably damaging	1.00
R6729:Trpm6	UTSW	19	18830297	missense	probably damaging	1.00
R6765:Trpm6	UTSW	19	18877765	missense	probably damaging	1.00
R6976:Trpm6	UTSW	19	18783163	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TCGTGATACTTATGCAAATCCTTCC -3'
(R):5'- AGGAACATATTGGTGATAGGTACTG -3'

Sequencing Primer
(F):5'- TGCAAATCCTTCCTACCTAAATTATC -3'
(R):5'- AGCTGTTGCGAGGTAACTGAC -3'

Posted On

2015-01-23