Incidental Mutation 'R3720:Kif1c'
ID258862
Institutional Source Beutler Lab
Gene Symbol Kif1c
Ensembl Gene ENSMUSG00000020821
Gene Namekinesin family member 1C
SynonymsB430105J22Rik, D11Bwg1349e, Orch3, N-3 kinsin
MMRRC Submission 040711-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3720 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location70700548-70731964 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70703771 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 86 (F86L)
Ref Sequence ENSEMBL: ENSMUSP00000123242 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072187] [ENSMUST00000073625] [ENSMUST00000094499] [ENSMUST00000102554] [ENSMUST00000108541] [ENSMUST00000108542] [ENSMUST00000108543] [ENSMUST00000126114] [ENSMUST00000137119] [ENSMUST00000152618]
Predicted Effect possibly damaging
Transcript: ENSMUST00000072187
AA Change: F86L

PolyPhen 2 Score 0.871 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000072048
Gene: ENSMUSG00000020821
AA Change: F86L

DomainStartEndE-ValueType
KISc 3 356 6.18e-175 SMART
low complexity region 402 418 N/A INTRINSIC
FHA 522 575 1.45e-2 SMART
low complexity region 607 622 N/A INTRINSIC
coiled coil region 634 673 N/A INTRINSIC
coiled coil region 842 883 N/A INTRINSIC
low complexity region 955 975 N/A INTRINSIC
low complexity region 1009 1055 N/A INTRINSIC
low complexity region 1072 1100 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000073625
SMART Domains Protein: ENSMUSP00000073311
Gene: ENSMUSG00000057054

DomainStartEndE-ValueType
Pfam:INCA1 12 187 7.7e-94 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000094499
AA Change: F86L

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000092075
Gene: ENSMUSG00000020821
AA Change: F86L

DomainStartEndE-ValueType
KISc 3 356 6.18e-175 SMART
low complexity region 402 418 N/A INTRINSIC
FHA 522 575 1.45e-2 SMART
low complexity region 607 622 N/A INTRINSIC
coiled coil region 634 671 N/A INTRINSIC
coiled coil region 830 871 N/A INTRINSIC
low complexity region 943 963 N/A INTRINSIC
low complexity region 997 1043 N/A INTRINSIC
low complexity region 1060 1088 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000102554
AA Change: F86L

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000099614
Gene: ENSMUSG00000020821
AA Change: F86L

DomainStartEndE-ValueType
KISc 3 356 6.18e-175 SMART
low complexity region 402 418 N/A INTRINSIC
FHA 522 575 1.45e-2 SMART
low complexity region 607 622 N/A INTRINSIC
coiled coil region 634 671 N/A INTRINSIC
coiled coil region 830 871 N/A INTRINSIC
low complexity region 943 963 N/A INTRINSIC
low complexity region 997 1043 N/A INTRINSIC
low complexity region 1060 1088 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108541
SMART Domains Protein: ENSMUSP00000104181
Gene: ENSMUSG00000057054

DomainStartEndE-ValueType
Pfam:INCA1 12 187 7.7e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108542
SMART Domains Protein: ENSMUSP00000104182
Gene: ENSMUSG00000057054

DomainStartEndE-ValueType
Pfam:INCA1 12 187 7.7e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108543
SMART Domains Protein: ENSMUSP00000104183
Gene: ENSMUSG00000057054

DomainStartEndE-ValueType
Pfam:INCA1 1 152 1.5e-81 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126114
SMART Domains Protein: ENSMUSP00000118761
Gene: ENSMUSG00000057054

DomainStartEndE-ValueType
Pfam:INCA1 12 187 8.4e-91 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000137119
AA Change: F86L

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000123242
Gene: ENSMUSG00000020821
AA Change: F86L

DomainStartEndE-ValueType
KISc 3 356 6.18e-175 SMART
low complexity region 402 418 N/A INTRINSIC
FHA 522 575 1.45e-2 SMART
low complexity region 607 622 N/A INTRINSIC
coiled coil region 634 671 N/A INTRINSIC
coiled coil region 830 871 N/A INTRINSIC
low complexity region 943 963 N/A INTRINSIC
low complexity region 997 1043 N/A INTRINSIC
low complexity region 1060 1088 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000152618
AA Change: F86L

PolyPhen 2 Score 0.503 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000136258
Gene: ENSMUSG00000020821
AA Change: F86L

DomainStartEndE-ValueType
KISc 3 356 6.18e-175 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197857
Meta Mutation Damage Score 0.25 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 93% (40/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the kinesin-like protein family. The family members are microtubule-dependent molecular motors that transport organelles within cells and move chromosomes during cell division. Mutations in this gene are a cause of spastic ataxia 2, autosomal recessive. [provided by RefSeq, May 2014]
PHENOTYPE: Mice homozygous for a reporter allele are viable, fertile and overtly normal and display normal motor-dependent retrograde Golgi apparatus-to-endoplasmic reticulum transport. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Appl1 G A 14: 26,927,844 T575M probably damaging Het
Atp2c1 A T 9: 105,422,976 M708K probably damaging Het
C9 A G 15: 6,483,119 T241A possibly damaging Het
Ccrl2 T C 9: 111,056,364 D22G probably benign Het
Cd47 A G 16: 49,867,842 I42V probably benign Het
Cntnap5c T C 17: 58,330,202 S1025P probably benign Het
Col8a1 T C 16: 57,626,916 M744V unknown Het
Cstf3 A G 2: 104,653,086 probably benign Het
Dnah8 G A 17: 30,854,898 R4514H probably damaging Het
Dnaic1 G A 4: 41,602,615 R113H probably damaging Het
Fry T C 5: 150,454,572 S410P probably damaging Het
Glt6d1 ACCC ACCCC 2: 25,795,167 probably null Het
Gm10717 A G 9: 3,025,532 Y39C probably benign Het
Hivep1 C T 13: 42,158,601 T1439I probably benign Het
Iqgap2 T C 13: 95,668,528 probably null Het
Kbtbd11 T A 8: 15,029,118 C572* probably null Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Ldb1 C T 19: 46,044,892 probably benign Het
Lrmda T A 14: 22,027,331 probably benign Het
Med23 T C 10: 24,891,120 L369S probably damaging Het
Mei1 A G 15: 82,103,204 H399R possibly damaging Het
Myo1b G T 1: 51,776,346 H614N possibly damaging Het
Neurl1b C T 17: 26,414,975 T4M probably damaging Het
Olfr1095 T C 2: 86,851,591 T36A probably benign Het
Olfr129 T C 17: 38,055,368 Y66C probably damaging Het
Polg G A 7: 79,456,791 Q163* probably null Het
Pramef8 A G 4: 143,419,379 T473A probably benign Het
Sdk2 G A 11: 113,800,244 P1835L probably damaging Het
Slc35a5 A T 16: 45,147,322 I138N probably damaging Het
Snx31 T C 15: 36,523,558 probably null Het
Speg A T 1: 75,426,782 H2590L probably damaging Het
Spink4 T A 4: 40,929,136 C54S probably damaging Het
Swap70 A G 7: 110,270,047 E349G probably damaging Het
Sybu A G 15: 44,672,632 V766A possibly damaging Het
Tns3 G A 11: 8,492,999 R455W probably damaging Het
Tnxb T A 17: 34,712,964 V2157E possibly damaging Het
Trak2 A T 1: 58,946,245 probably null Het
Trav18 C T 14: 53,831,617 R39C possibly damaging Het
Uroc1 G A 6: 90,346,355 V352M probably damaging Het
Zfp106 A C 2: 120,534,599 I442M probably benign Het
Zfp935 G A 13: 62,455,032 Q98* probably null Het
Other mutations in Kif1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00775:Kif1c APN 11 70724134 splice site probably null
IGL00817:Kif1c APN 11 70705253 missense probably benign 0.25
IGL00849:Kif1c APN 11 70706127 missense probably damaging 1.00
IGL01988:Kif1c APN 11 70704936 missense probably damaging 1.00
IGL02683:Kif1c APN 11 70726452 missense possibly damaging 0.85
IGL03024:Kif1c APN 11 70705189 missense probably damaging 1.00
R0570:Kif1c UTSW 11 70704465 missense probably damaging 0.96
R0647:Kif1c UTSW 11 70726141 missense probably damaging 1.00
R0710:Kif1c UTSW 11 70726497 missense probably benign
R1112:Kif1c UTSW 11 70724815 splice site probably null
R1199:Kif1c UTSW 11 70708601 missense possibly damaging 0.69
R1514:Kif1c UTSW 11 70705729 missense probably damaging 1.00
R1660:Kif1c UTSW 11 70728397 missense probably damaging 0.99
R1661:Kif1c UTSW 11 70728397 missense probably damaging 0.99
R1666:Kif1c UTSW 11 70728397 missense probably damaging 0.99
R1669:Kif1c UTSW 11 70728397 missense probably damaging 0.99
R1707:Kif1c UTSW 11 70728397 missense probably damaging 0.99
R1708:Kif1c UTSW 11 70728397 missense probably damaging 0.99
R1835:Kif1c UTSW 11 70708971 missense probably damaging 0.99
R1861:Kif1c UTSW 11 70703342 missense probably damaging 1.00
R2870:Kif1c UTSW 11 70724081 missense probably damaging 0.99
R2870:Kif1c UTSW 11 70724081 missense probably damaging 0.99
R2871:Kif1c UTSW 11 70724081 missense probably damaging 0.99
R2871:Kif1c UTSW 11 70724081 missense probably damaging 0.99
R2872:Kif1c UTSW 11 70724081 missense probably damaging 0.99
R2872:Kif1c UTSW 11 70724081 missense probably damaging 0.99
R2927:Kif1c UTSW 11 70726314 missense probably benign
R4809:Kif1c UTSW 11 70726357 missense probably benign 0.10
R4914:Kif1c UTSW 11 70708855 missense probably damaging 0.99
R5642:Kif1c UTSW 11 70708447 missense probably benign 0.14
R5788:Kif1c UTSW 11 70708828 missense probably damaging 1.00
R5861:Kif1c UTSW 11 70703795 missense probably damaging 1.00
R6918:Kif1c UTSW 11 70706987 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATCAGACCTTTGGGCAGTCAG -3'
(R):5'- GGTATTAGGTTGCAGCCAAGC -3'

Sequencing Primer
(F):5'- CAGTCAGAGCCGTCAGGATG -3'
(R):5'- GGTTGCAGCCAAGCCTTATATC -3'
Posted On2015-01-23