Incidental Mutation 'R3721:Pomgnt1'
ID258898
Institutional Source Beutler Lab
Gene Symbol Pomgnt1
Ensembl Gene ENSMUSG00000028700
Gene Nameprotein O-linked mannose beta 1,2-N-acetylglucosaminyltransferase
Synonyms0610016I07Rik, 4930467B06Rik
MMRRC Submission 040712-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3721 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location116123840-116159849 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to G at 116153543 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000112911 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106494] [ENSMUST00000106496] [ENSMUST00000106498] [ENSMUST00000120083] [ENSMUST00000121052]
Predicted Effect probably benign
Transcript: ENSMUST00000106494
SMART Domains Protein: ENSMUSP00000102103
Gene: ENSMUSG00000028700

DomainStartEndE-ValueType
transmembrane domain 20 37 N/A INTRINSIC
low complexity region 60 75 N/A INTRINSIC
PDB:2YOQ|C 106 195 6e-10 PDB
Pfam:GNT-I 271 591 3e-52 PFAM
low complexity region 623 636 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106496
SMART Domains Protein: ENSMUSP00000102105
Gene: ENSMUSG00000028700

DomainStartEndE-ValueType
low complexity region 82 97 N/A INTRINSIC
PDB:2YOP|C 129 217 5e-10 PDB
Pfam:GNT-I 260 580 2.9e-52 PFAM
low complexity region 612 625 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106498
SMART Domains Protein: ENSMUSP00000102107
Gene: ENSMUSG00000028700

DomainStartEndE-ValueType
low complexity region 82 97 N/A INTRINSIC
PDB:2YOQ|C 129 217 6e-10 PDB
Pfam:GNT-I 293 613 3.2e-52 PFAM
low complexity region 645 658 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120083
SMART Domains Protein: ENSMUSP00000112751
Gene: ENSMUSG00000028700

DomainStartEndE-ValueType
low complexity region 82 97 N/A INTRINSIC
Pfam:ILEI 129 220 8.9e-28 PFAM
Pfam:GNT-I 293 612 1.9e-51 PFAM
low complexity region 645 658 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121052
SMART Domains Protein: ENSMUSP00000112911
Gene: ENSMUSG00000028700

DomainStartEndE-ValueType
low complexity region 82 97 N/A INTRINSIC
PDB:2YOQ|C 129 217 6e-10 PDB
Pfam:GNT-I 293 613 3.2e-52 PFAM
low complexity region 645 658 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127426
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133838
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135982
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136855
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147612
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151325
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155718
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type II transmembrane protein that resides in the Golgi apparatus. It participates in O-mannosyl glycosylation and is specific for alpha linked terminal mannose. Mutations in this gene may be associated with muscle-eye-brain disease and several congenital muscular dystrophies. Alternatively spliced transcript variants that encode different protein isoforms have been described. [provided by RefSeq, Feb 2014]
PHENOTYPE: Surviving homozygous null mice display a mild dystrophy despite a reduced muscle mass and myofiber number, impaired muscle regeneration and low proliferative activity of satellite cells. Mice homozygous for a gene trap allele show reduced fertility and multiple defects in muscle, eye and brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr2a T C 2: 48,892,138 S228P probably damaging Het
Adamts2 C T 11: 50,773,211 probably benign Het
Arhgap9 A G 10: 127,328,971 E588G possibly damaging Het
Ash2l C G 8: 25,818,625 G453A probably damaging Het
Catsperg2 A G 7: 29,705,102 V638A probably benign Het
Ccrl2 T C 9: 111,056,364 D22G probably benign Het
Cdc73 T C 1: 143,695,453 I83V possibly damaging Het
Clec2e C A 6: 129,094,410 E155* probably null Het
Cyp3a59 T A 5: 146,096,597 M181K probably damaging Het
Dars2 A T 1: 161,063,308 V111E probably benign Het
Diras2 T A 13: 52,508,023 I83F probably damaging Het
Dlg2 T A 7: 91,711,800 probably null Het
Dnaic1 G A 4: 41,602,615 R113H probably damaging Het
Emilin2 T C 17: 71,273,454 N759S probably benign Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Fam102b C T 3: 108,979,767 R305Q probably damaging Het
Ggnbp1 T C 17: 27,029,613 V52A probably benign Het
Gm5155 A G 7: 17,902,738 T247A probably benign Het
Gpr171 A G 3: 59,097,670 V228A possibly damaging Het
Gsta3 T C 1: 21,260,089 M55T probably benign Het
Hectd3 T A 4: 116,999,745 N496K probably benign Het
Hp1bp3 T G 4: 138,239,608 F367V probably damaging Het
Il18rap T A 1: 40,537,088 L253Q probably damaging Het
Irs1 C T 1: 82,290,085 G137S probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lair1 A C 7: 4,010,783 L155R probably damaging Het
Larp7 A G 3: 127,546,811 L126P probably damaging Het
Lhx1 G A 11: 84,521,828 R89C probably damaging Het
Lypd4 C A 7: 24,865,459 A85S probably benign Het
Mei1 A G 15: 82,103,204 H399R possibly damaging Het
Myh10 G T 11: 68,813,052 R1863L probably damaging Het
Myo9a G A 9: 59,868,180 V1025I probably benign Het
Naa25 T A 5: 121,431,556 D659E probably benign Het
Nol9 A G 4: 152,039,706 S118G probably benign Het
Olfr497 G T 7: 108,423,119 D183Y probably damaging Het
Olfr730 C T 14: 50,186,680 C179Y probably damaging Het
Pde10a T A 17: 8,969,589 I907N probably damaging Het
Pkhd1 T C 1: 20,585,655 D218G probably benign Het
Poll A G 19: 45,553,577 I430T probably damaging Het
Rab6b T C 9: 103,167,174 probably null Het
Rad1 T C 15: 10,488,026 S79P probably benign Het
Ranbp17 GCCTGGATACTGACC GCC 11: 33,219,203 probably benign Het
Rcc1 T C 4: 132,337,814 K133E possibly damaging Het
Ric8a T C 7: 140,861,961 probably null Het
Rnf135 G T 11: 80,196,917 A231S probably benign Het
Rps6ka4 A G 19: 6,839,277 V146A possibly damaging Het
Sh3bp4 A G 1: 89,145,328 I633V possibly damaging Het
Slc2a2 T A 3: 28,727,152 N446K probably damaging Het
Slc44a1 T C 4: 53,491,445 Y61H probably damaging Het
Slc7a1 G A 5: 148,335,533 R445* probably null Het
Smc5 T C 19: 23,210,492 M911V probably benign Het
Sntb1 C A 15: 55,642,818 R453L probably benign Het
Spink4 T A 4: 40,929,136 C54S probably damaging Het
Srrm2 CTCCTCTTCTTCCTCTTCTTCCTC CTCCTCTTCTTCCTC 17: 23,822,575 probably benign Het
Trpm1 T G 7: 64,217,727 probably benign Het
Tufm T C 7: 126,490,460 M442T probably benign Het
Ubn1 A G 16: 5,073,378 N539S possibly damaging Het
Other mutations in Pomgnt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00534:Pomgnt1 APN 4 116152761 missense probably damaging 1.00
IGL02001:Pomgnt1 APN 4 116152908 nonsense probably null
IGL02582:Pomgnt1 APN 4 116158550 missense probably damaging 1.00
pomegranate UTSW 4 116154890 missense probably damaging 1.00
R0206:Pomgnt1 UTSW 4 116158560 critical splice donor site probably null
R0688:Pomgnt1 UTSW 4 116155889 missense probably damaging 1.00
R0890:Pomgnt1 UTSW 4 116152185 missense probably benign 0.25
R0927:Pomgnt1 UTSW 4 116151851 missense probably damaging 1.00
R1942:Pomgnt1 UTSW 4 116155275 splice site probably null
R1983:Pomgnt1 UTSW 4 116151869 missense probably damaging 1.00
R1983:Pomgnt1 UTSW 4 116151920 missense probably benign 0.12
R2034:Pomgnt1 UTSW 4 116157927 missense possibly damaging 0.87
R3774:Pomgnt1 UTSW 4 116154128 missense probably damaging 1.00
R3775:Pomgnt1 UTSW 4 116154128 missense probably damaging 1.00
R3815:Pomgnt1 UTSW 4 116153942 critical splice donor site probably null
R3816:Pomgnt1 UTSW 4 116153942 critical splice donor site probably null
R3817:Pomgnt1 UTSW 4 116153942 critical splice donor site probably null
R3818:Pomgnt1 UTSW 4 116153942 critical splice donor site probably null
R4447:Pomgnt1 UTSW 4 116152923 missense possibly damaging 0.75
R4583:Pomgnt1 UTSW 4 116158494 missense probably benign 0.03
R4616:Pomgnt1 UTSW 4 116154890 missense probably damaging 1.00
R4690:Pomgnt1 UTSW 4 116155510 missense probably damaging 1.00
R4717:Pomgnt1 UTSW 4 116154215 missense possibly damaging 0.50
R4719:Pomgnt1 UTSW 4 116155775 missense probably damaging 1.00
R4747:Pomgnt1 UTSW 4 116156199 missense probably damaging 1.00
R5108:Pomgnt1 UTSW 4 116156256 intron probably benign
R5569:Pomgnt1 UTSW 4 116155967 missense probably damaging 1.00
R5821:Pomgnt1 UTSW 4 116155736 missense probably benign 0.16
R5937:Pomgnt1 UTSW 4 116153913 missense probably benign 0.01
R6052:Pomgnt1 UTSW 4 116151602 missense possibly damaging 0.91
R6745:Pomgnt1 UTSW 4 116153883 missense probably damaging 0.97
R6949:Pomgnt1 UTSW 4 116154154 missense probably damaging 0.97
R7503:Pomgnt1 UTSW 4 116152752 missense possibly damaging 0.76
T0722:Pomgnt1 UTSW 4 116137427 unclassified probably benign
T0975:Pomgnt1 UTSW 4 116137427 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GCATTTTAGGGAGGGAGCAC -3'
(R):5'- CTCCTCCCTTGATACTACAGGG -3'

Sequencing Primer
(F):5'- GACTTGGGATGAGTCTCAGAC -3'
(R):5'- TCCCTTGATACTACAGGGTGGAC -3'
Posted On2015-01-23