Incidental Mutation 'R3721:Hp1bp3'
ID258901
Institutional Source Beutler Lab
Gene Symbol Hp1bp3
Ensembl Gene ENSMUSG00000028759
Gene Nameheterochromatin protein 1, binding protein 3
SynonymsHp1bp74
MMRRC Submission 040712-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.769) question?
Stock #R3721 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location138216296-138244683 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 138239608 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Valine at position 367 (F367V)
Ref Sequence ENSEMBL: ENSMUSP00000101451 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030541] [ENSMUST00000097836] [ENSMUST00000105825] [ENSMUST00000105826] [ENSMUST00000105827] [ENSMUST00000148681] [ENSMUST00000165861]
Predicted Effect probably damaging
Transcript: ENSMUST00000030541
AA Change: F405V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030541
Gene: ENSMUSG00000028759
AA Change: F405V

DomainStartEndE-ValueType
low complexity region 96 133 N/A INTRINSIC
H15 157 224 2.82e-18 SMART
H15 253 320 7.29e-12 SMART
H15 335 403 1.78e-15 SMART
low complexity region 427 451 N/A INTRINSIC
low complexity region 491 512 N/A INTRINSIC
low complexity region 540 554 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000097836
AA Change: F367V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095447
Gene: ENSMUSG00000028759
AA Change: F367V

DomainStartEndE-ValueType
low complexity region 58 95 N/A INTRINSIC
H15 119 186 2.82e-18 SMART
H15 215 282 7.29e-12 SMART
H15 297 365 1.78e-15 SMART
low complexity region 389 413 N/A INTRINSIC
low complexity region 453 474 N/A INTRINSIC
low complexity region 502 516 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105825
AA Change: F367V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101451
Gene: ENSMUSG00000028759
AA Change: F367V

DomainStartEndE-ValueType
low complexity region 58 95 N/A INTRINSIC
H15 119 186 1.3e-17 SMART
H15 215 282 7.29e-12 SMART
H15 297 365 1.78e-15 SMART
low complexity region 389 413 N/A INTRINSIC
low complexity region 453 474 N/A INTRINSIC
low complexity region 502 516 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105826
AA Change: F405V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101452
Gene: ENSMUSG00000028759
AA Change: F405V

DomainStartEndE-ValueType
low complexity region 96 133 N/A INTRINSIC
H15 157 224 1.3e-17 SMART
H15 253 320 7.29e-12 SMART
H15 335 403 1.78e-15 SMART
low complexity region 427 451 N/A INTRINSIC
low complexity region 491 512 N/A INTRINSIC
low complexity region 540 554 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105827
AA Change: F405V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101453
Gene: ENSMUSG00000028759
AA Change: F405V

DomainStartEndE-ValueType
low complexity region 96 133 N/A INTRINSIC
H15 157 224 1.3e-17 SMART
H15 253 320 7.29e-12 SMART
H15 335 403 1.78e-15 SMART
low complexity region 427 451 N/A INTRINSIC
low complexity region 491 512 N/A INTRINSIC
low complexity region 540 554 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000148681
AA Change: F241V

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000122005
Gene: ENSMUSG00000028759
AA Change: F241V

DomainStartEndE-ValueType
H15 3 60 2.05e-6 SMART
H15 89 156 7.29e-12 SMART
H15 171 239 1.78e-15 SMART
low complexity region 263 287 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000165861
AA Change: F405V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132614
Gene: ENSMUSG00000028759
AA Change: F405V

DomainStartEndE-ValueType
low complexity region 96 133 N/A INTRINSIC
H15 157 224 2.82e-18 SMART
H15 253 320 7.29e-12 SMART
H15 335 403 1.78e-15 SMART
low complexity region 427 451 N/A INTRINSIC
low complexity region 491 512 N/A INTRINSIC
low complexity region 540 554 N/A INTRINSIC
Meta Mutation Damage Score 0.52 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 100% (59/59)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal lethality and reduced body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr2a T C 2: 48,892,138 S228P probably damaging Het
Adamts2 C T 11: 50,773,211 probably benign Het
Arhgap9 A G 10: 127,328,971 E588G possibly damaging Het
Ash2l C G 8: 25,818,625 G453A probably damaging Het
Catsperg2 A G 7: 29,705,102 V638A probably benign Het
Ccrl2 T C 9: 111,056,364 D22G probably benign Het
Cdc73 T C 1: 143,695,453 I83V possibly damaging Het
Clec2e C A 6: 129,094,410 E155* probably null Het
Cyp3a59 T A 5: 146,096,597 M181K probably damaging Het
Dars2 A T 1: 161,063,308 V111E probably benign Het
Diras2 T A 13: 52,508,023 I83F probably damaging Het
Dlg2 T A 7: 91,711,800 probably null Het
Dnaic1 G A 4: 41,602,615 R113H probably damaging Het
Emilin2 T C 17: 71,273,454 N759S probably benign Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Fam102b C T 3: 108,979,767 R305Q probably damaging Het
Ggnbp1 T C 17: 27,029,613 V52A probably benign Het
Gm5155 A G 7: 17,902,738 T247A probably benign Het
Gpr171 A G 3: 59,097,670 V228A possibly damaging Het
Gsta3 T C 1: 21,260,089 M55T probably benign Het
Hectd3 T A 4: 116,999,745 N496K probably benign Het
Il18rap T A 1: 40,537,088 L253Q probably damaging Het
Irs1 C T 1: 82,290,085 G137S probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lair1 A C 7: 4,010,783 L155R probably damaging Het
Larp7 A G 3: 127,546,811 L126P probably damaging Het
Lhx1 G A 11: 84,521,828 R89C probably damaging Het
Lypd4 C A 7: 24,865,459 A85S probably benign Het
Mei1 A G 15: 82,103,204 H399R possibly damaging Het
Myh10 G T 11: 68,813,052 R1863L probably damaging Het
Myo9a G A 9: 59,868,180 V1025I probably benign Het
Naa25 T A 5: 121,431,556 D659E probably benign Het
Nol9 A G 4: 152,039,706 S118G probably benign Het
Olfr497 G T 7: 108,423,119 D183Y probably damaging Het
Olfr730 C T 14: 50,186,680 C179Y probably damaging Het
Pde10a T A 17: 8,969,589 I907N probably damaging Het
Pkhd1 T C 1: 20,585,655 D218G probably benign Het
Poll A G 19: 45,553,577 I430T probably damaging Het
Pomgnt1 T G 4: 116,153,543 probably benign Het
Rab6b T C 9: 103,167,174 probably null Het
Rad1 T C 15: 10,488,026 S79P probably benign Het
Ranbp17 GCCTGGATACTGACC GCC 11: 33,219,203 probably benign Het
Rcc1 T C 4: 132,337,814 K133E possibly damaging Het
Ric8a T C 7: 140,861,961 probably null Het
Rnf135 G T 11: 80,196,917 A231S probably benign Het
Rps6ka4 A G 19: 6,839,277 V146A possibly damaging Het
Sh3bp4 A G 1: 89,145,328 I633V possibly damaging Het
Slc2a2 T A 3: 28,727,152 N446K probably damaging Het
Slc44a1 T C 4: 53,491,445 Y61H probably damaging Het
Slc7a1 G A 5: 148,335,533 R445* probably null Het
Smc5 T C 19: 23,210,492 M911V probably benign Het
Sntb1 C A 15: 55,642,818 R453L probably benign Het
Spink4 T A 4: 40,929,136 C54S probably damaging Het
Srrm2 CTCCTCTTCTTCCTCTTCTTCCTC CTCCTCTTCTTCCTC 17: 23,822,575 probably benign Het
Trpm1 T G 7: 64,217,727 probably benign Het
Tufm T C 7: 126,490,460 M442T probably benign Het
Ubn1 A G 16: 5,073,378 N539S possibly damaging Het
Other mutations in Hp1bp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01023:Hp1bp3 APN 4 138240629 missense possibly damaging 0.85
IGL02407:Hp1bp3 APN 4 138240672 missense probably damaging 1.00
IGL03036:Hp1bp3 APN 4 138228732 missense probably damaging 1.00
Supermicro UTSW 4 138225897 missense probably damaging 1.00
R0009:Hp1bp3 UTSW 4 138221683 missense probably benign 0.45
R0009:Hp1bp3 UTSW 4 138221683 missense probably benign 0.45
R0128:Hp1bp3 UTSW 4 138237209 missense probably damaging 1.00
R0130:Hp1bp3 UTSW 4 138237209 missense probably damaging 1.00
R0131:Hp1bp3 UTSW 4 138237209 missense probably damaging 1.00
R0131:Hp1bp3 UTSW 4 138237209 missense probably damaging 1.00
R0132:Hp1bp3 UTSW 4 138237209 missense probably damaging 1.00
R0344:Hp1bp3 UTSW 4 138237209 missense probably damaging 1.00
R0522:Hp1bp3 UTSW 4 138222161 missense possibly damaging 0.77
R0652:Hp1bp3 UTSW 4 138228769 missense possibly damaging 0.75
R1240:Hp1bp3 UTSW 4 138229698 missense probably damaging 1.00
R1793:Hp1bp3 UTSW 4 138230509 missense probably damaging 1.00
R1871:Hp1bp3 UTSW 4 138222186 missense probably damaging 1.00
R2018:Hp1bp3 UTSW 4 138221632 missense probably damaging 1.00
R2060:Hp1bp3 UTSW 4 138240672 missense probably damaging 1.00
R2255:Hp1bp3 UTSW 4 138225898 missense probably damaging 0.98
R3930:Hp1bp3 UTSW 4 138221707 missense probably benign 0.29
R5042:Hp1bp3 UTSW 4 138222108 start codon destroyed probably null 0.99
R5423:Hp1bp3 UTSW 4 138225897 missense probably damaging 1.00
R5583:Hp1bp3 UTSW 4 138222115 missense probably damaging 1.00
R5597:Hp1bp3 UTSW 4 138221628 start codon destroyed possibly damaging 0.91
R6051:Hp1bp3 UTSW 4 138234304 missense possibly damaging 0.93
R6208:Hp1bp3 UTSW 4 138217170 start gained probably benign
R7077:Hp1bp3 UTSW 4 138239618 missense probably damaging 1.00
X0027:Hp1bp3 UTSW 4 138241673 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGCACAAAGGACTATACTAGTTC -3'
(R):5'- TCAAGACAGCAGGAATGCCC -3'

Sequencing Primer
(F):5'- AGGACTATACTAGTTCATGTCTGTG -3'
(R):5'- AGCAGGAATGCCCACTCTAGTG -3'
Posted On2015-01-23