Incidental Mutation 'R3721:Lhx1'
ID258924
Institutional Source Beutler Lab
Gene Symbol Lhx1
Ensembl Gene ENSMUSG00000018698
Gene NameLIM homeobox protein 1
SynonymsLim1
MMRRC Submission 040712-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3721 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location84518284-84525535 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 84521828 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 89 (R89C)
Ref Sequence ENSEMBL: ENSMUSP00000138899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018842] [ENSMUST00000092827] [ENSMUST00000184646]
Predicted Effect probably damaging
Transcript: ENSMUST00000018842
AA Change: R180C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000018842
Gene: ENSMUSG00000018698
AA Change: R180C

DomainStartEndE-ValueType
LIM 3 54 5.51e-17 SMART
LIM 62 117 4.24e-18 SMART
low complexity region 137 156 N/A INTRINSIC
HOX 180 242 1.33e-22 SMART
low complexity region 315 327 N/A INTRINSIC
low complexity region 349 367 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092827
SMART Domains Protein: ENSMUSP00000090503
Gene: ENSMUSG00000018698

DomainStartEndE-ValueType
LIM 18 73 4.24e-18 SMART
low complexity region 93 112 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126072
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128121
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134800
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176503
SMART Domains Protein: ENSMUSP00000135334
Gene: ENSMUSG00000018698

DomainStartEndE-ValueType
Pfam:Homeobox 1 17 5.3e-6 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000184646
AA Change: R89C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138899
Gene: ENSMUSG00000018698
AA Change: R89C

DomainStartEndE-ValueType
low complexity region 46 65 N/A INTRINSIC
HOX 89 151 6.8e-25 SMART
low complexity region 224 236 N/A INTRINSIC
low complexity region 258 276 N/A INTRINSIC
Meta Mutation Damage Score 0.024 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a large protein family which contains the LIM domain, a unique cysteine-rich zinc-binding domain. The encoded protein is a transcription factor important for the development of the renal and urogenital systems. This gene is a candidate for Mayer-Rokitansky-Kuster-Hauser syndrome, a disorder characterized by anomalies in the female genital tract. [provided by RefSeq, Dec 2010]
PHENOTYPE: Homozygotes for targeted null mutations are small, fail to develop head structures anterior to rhombomere 3 in the hindbrain, lack kidneys and gonads, and show aberrant trajectories of limb motor axons. Most mutants die around embryonic day 10. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr2a T C 2: 48,892,138 S228P probably damaging Het
Adamts2 C T 11: 50,773,211 probably benign Het
Arhgap9 A G 10: 127,328,971 E588G possibly damaging Het
Ash2l C G 8: 25,818,625 G453A probably damaging Het
Catsperg2 A G 7: 29,705,102 V638A probably benign Het
Ccrl2 T C 9: 111,056,364 D22G probably benign Het
Cdc73 T C 1: 143,695,453 I83V possibly damaging Het
Clec2e C A 6: 129,094,410 E155* probably null Het
Cyp3a59 T A 5: 146,096,597 M181K probably damaging Het
Dars2 A T 1: 161,063,308 V111E probably benign Het
Diras2 T A 13: 52,508,023 I83F probably damaging Het
Dlg2 T A 7: 91,711,800 probably null Het
Dnaic1 G A 4: 41,602,615 R113H probably damaging Het
Emilin2 T C 17: 71,273,454 N759S probably benign Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Fam102b C T 3: 108,979,767 R305Q probably damaging Het
Ggnbp1 T C 17: 27,029,613 V52A probably benign Het
Gm5155 A G 7: 17,902,738 T247A probably benign Het
Gpr171 A G 3: 59,097,670 V228A possibly damaging Het
Gsta3 T C 1: 21,260,089 M55T probably benign Het
Hectd3 T A 4: 116,999,745 N496K probably benign Het
Hp1bp3 T G 4: 138,239,608 F367V probably damaging Het
Il18rap T A 1: 40,537,088 L253Q probably damaging Het
Irs1 C T 1: 82,290,085 G137S probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lair1 A C 7: 4,010,783 L155R probably damaging Het
Larp7 A G 3: 127,546,811 L126P probably damaging Het
Lypd4 C A 7: 24,865,459 A85S probably benign Het
Mei1 A G 15: 82,103,204 H399R possibly damaging Het
Myh10 G T 11: 68,813,052 R1863L probably damaging Het
Myo9a G A 9: 59,868,180 V1025I probably benign Het
Naa25 T A 5: 121,431,556 D659E probably benign Het
Nol9 A G 4: 152,039,706 S118G probably benign Het
Olfr497 G T 7: 108,423,119 D183Y probably damaging Het
Olfr730 C T 14: 50,186,680 C179Y probably damaging Het
Pde10a T A 17: 8,969,589 I907N probably damaging Het
Pkhd1 T C 1: 20,585,655 D218G probably benign Het
Poll A G 19: 45,553,577 I430T probably damaging Het
Pomgnt1 T G 4: 116,153,543 probably benign Het
Rab6b T C 9: 103,167,174 probably null Het
Rad1 T C 15: 10,488,026 S79P probably benign Het
Ranbp17 GCCTGGATACTGACC GCC 11: 33,219,203 probably benign Het
Rcc1 T C 4: 132,337,814 K133E possibly damaging Het
Ric8a T C 7: 140,861,961 probably null Het
Rnf135 G T 11: 80,196,917 A231S probably benign Het
Rps6ka4 A G 19: 6,839,277 V146A possibly damaging Het
Sh3bp4 A G 1: 89,145,328 I633V possibly damaging Het
Slc2a2 T A 3: 28,727,152 N446K probably damaging Het
Slc44a1 T C 4: 53,491,445 Y61H probably damaging Het
Slc7a1 G A 5: 148,335,533 R445* probably null Het
Smc5 T C 19: 23,210,492 M911V probably benign Het
Sntb1 C A 15: 55,642,818 R453L probably benign Het
Spink4 T A 4: 40,929,136 C54S probably damaging Het
Srrm2 CTCCTCTTCTTCCTCTTCTTCCTC CTCCTCTTCTTCCTC 17: 23,822,575 probably benign Het
Trpm1 T G 7: 64,217,727 probably benign Het
Tufm T C 7: 126,490,460 M442T probably benign Het
Ubn1 A G 16: 5,073,378 N539S possibly damaging Het
Other mutations in Lhx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00757:Lhx1 APN 11 84519652 missense probably damaging 0.97
R1346:Lhx1 UTSW 11 84522079 missense possibly damaging 0.55
R1565:Lhx1 UTSW 11 84519821 missense probably benign 0.00
R1806:Lhx1 UTSW 11 84524141 missense probably damaging 1.00
R2148:Lhx1 UTSW 11 84519821 missense probably benign 0.00
R2449:Lhx1 UTSW 11 84521738 missense probably damaging 1.00
R3793:Lhx1 UTSW 11 84521900 missense probably benign 0.01
R4940:Lhx1 UTSW 11 84519909 nonsense probably null
R5178:Lhx1 UTSW 11 84520388 missense possibly damaging 0.69
R5877:Lhx1 UTSW 11 84522239 missense probably damaging 1.00
R6366:Lhx1 UTSW 11 84522208 missense probably damaging 1.00
R6551:Lhx1 UTSW 11 84521913 missense probably benign 0.23
R7060:Lhx1 UTSW 11 84520282 critical splice donor site probably null
R7106:Lhx1 UTSW 11 84522077 missense probably benign 0.00
R7133:Lhx1 UTSW 11 84519920 missense probably benign 0.00
R7161:Lhx1 UTSW 11 84519872 missense probably damaging 1.00
R7290:Lhx1 UTSW 11 84521877 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGGCCATTCGAGTCTTTGAG -3'
(R):5'- GGATTCCCAACTGGCTAGAG -3'

Sequencing Primer
(F):5'- TCTTTGAGAGACAGAGTGACAAACC -3'
(R):5'- CCAACTGGCTAGAGGGTGG -3'
Posted On2015-01-23