Incidental Mutation 'R3722:Ptprk'
ID258976
Institutional Source Beutler Lab
Gene Symbol Ptprk
Ensembl Gene ENSMUSG00000019889
Gene Nameprotein tyrosine phosphatase, receptor type, K
SynonymsRPTPkappa, PTPk
MMRRC Submission 040713-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3722 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location28074820-28597397 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 28383623 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 353 (D353G)
Ref Sequence ENSEMBL: ENSMUSP00000151866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166468] [ENSMUST00000218276] [ENSMUST00000218359]
Predicted Effect probably damaging
Transcript: ENSMUST00000166468
AA Change: D353G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126279
Gene: ENSMUSG00000019889
AA Change: D353G

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
MAM 30 193 1.61e-73 SMART
IG 200 288 2.16e-8 SMART
FN3 290 373 1.48e-4 SMART
FN3 389 475 4.24e1 SMART
FN3 491 579 3.32e-7 SMART
transmembrane domain 753 774 N/A INTRINSIC
PTPc 898 1161 3.56e-132 SMART
PTPc 1190 1455 2.68e-86 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000218276
AA Change: D353G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000218359
AA Change: D353G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218584
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218633
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219478
Meta Mutation Damage Score 0.098 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP mu (MAM) domain, an Ig-like domain and four fibronectin type III-like repeats. This PTP was shown to mediate homophilic intercellular interaction, possibly through the interaction with beta- and gamma-catenin at adherens junctions. Expression of this gene was found to be stimulated by TGF-beta 1, which may be important for the inhibition of keratinocyte proliferation. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb A T 10: 10,340,510 S1485T probably benign Het
Akap9 A G 5: 4,070,351 Y3589C probably damaging Het
Alkbh8 T C 9: 3,385,153 Y482H probably damaging Het
Appl1 G A 14: 26,927,844 T575M probably damaging Het
Arhgap21 T C 2: 20,850,291 E1420G probably damaging Het
Asic3 A T 5: 24,416,999 Y419F probably benign Het
Atg7 A G 6: 114,695,663 Y279C probably damaging Het
Braf G A 6: 39,623,676 P616L probably damaging Het
Btnl2 T C 17: 34,358,135 M88T possibly damaging Het
C1rb T A 6: 124,580,661 Y586N probably damaging Het
Cacna1s T C 1: 136,069,042 F127S possibly damaging Het
Cd47 A G 16: 49,867,842 I42V probably benign Het
Cox8b T A 7: 140,899,005 K66* probably null Het
Diras2 T A 13: 52,508,023 I83F probably damaging Het
Dlg2 T A 7: 91,711,800 probably null Het
Dnah8 G A 17: 30,854,898 R4514H probably damaging Het
Dnaic1 G A 4: 41,602,615 R113H probably damaging Het
Dolpp1 T C 2: 30,397,488 L204P probably damaging Het
Fam170a C T 18: 50,282,204 P306S probably benign Het
Fam205a1 T C 4: 42,851,472 E228G probably benign Het
Fbxl12 A T 9: 20,638,972 probably null Het
Fndc3a T A 14: 72,540,208 I1186F probably benign Het
Gm12886 T A 4: 121,417,470 D71V probably damaging Het
Hist1h3g T C 13: 23,535,552 V36A possibly damaging Het
Ica1 A G 6: 8,659,021 probably benign Het
Ighv8-11 A G 12: 115,567,151 I119T possibly damaging Het
Ism1 A T 2: 139,732,011 R94* probably null Het
Kbtbd11 T A 8: 15,029,118 C572* probably null Het
Kcnk15 T C 2: 163,858,294 L132P probably damaging Het
Lrmda T A 14: 22,027,331 probably benign Het
Mei1 A G 15: 82,103,204 H399R possibly damaging Het
Mkl2 C T 16: 13,385,693 A201V probably damaging Het
Ncstn G A 1: 172,067,895 T562M possibly damaging Het
Nudt4 A T 10: 95,549,505 probably null Het
Olfr1248 A T 2: 89,618,159 I11N possibly damaging Het
Olfr958 A C 9: 39,550,122 C250G probably damaging Het
Omp T C 7: 98,145,213 N69S probably benign Het
Pak1 C T 7: 97,854,497 P13L probably damaging Het
Pde4d T A 13: 109,951,332 C744* probably null Het
Pelp1 T C 11: 70,398,200 Y240C possibly damaging Het
Pou2f1 G C 1: 165,894,969 P349R probably damaging Het
Ptprs A G 17: 56,417,485 F1152S probably damaging Het
Rnf135 G T 11: 80,196,917 A231S probably benign Het
Rpn1 G A 6: 88,090,300 probably null Het
Rreb1 T A 13: 37,947,098 D1409E probably benign Het
Sipa1l2 G A 8: 125,473,584 H668Y probably damaging Het
Slc35a5 A T 16: 45,147,322 I138N probably damaging Het
Slc35d1 T C 4: 103,208,124 K187E possibly damaging Het
Slc44a2 A T 9: 21,342,977 I212F possibly damaging Het
Slc7a1 G A 5: 148,335,533 R445* probably null Het
Snapc4 A G 2: 26,365,428 L1028P probably benign Het
Snrnp40 C T 4: 130,368,275 T152I possibly damaging Het
Spink4 T A 4: 40,929,136 C54S probably damaging Het
Tex2 C T 11: 106,546,740 W203* probably null Het
Tmcc1 T C 6: 116,133,822 E170G possibly damaging Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Ttll6 A G 11: 96,133,921 N46D probably benign Het
Txk T A 5: 72,707,735 K266* probably null Het
Uggt2 T C 14: 119,041,518 E859G probably damaging Het
Uros A T 7: 133,702,391 M1K probably null Het
Vps13b T A 15: 35,671,382 I1677N probably damaging Het
Zbtb5 A G 4: 44,994,863 probably null Het
Zfp760 A G 17: 21,722,162 Y106C probably damaging Het
Other mutations in Ptprk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00310:Ptprk APN 10 28336510 missense possibly damaging 0.92
IGL00533:Ptprk APN 10 28585975 missense probably damaging 0.97
IGL01062:Ptprk APN 10 28580418 missense probably damaging 1.00
IGL01295:Ptprk APN 10 28475178 missense probably benign 0.14
IGL01372:Ptprk APN 10 28569927 missense probably benign 0.00
IGL01452:Ptprk APN 10 28574917 critical splice donor site probably null
IGL01829:Ptprk APN 10 28573387 missense probably damaging 1.00
IGL01861:Ptprk APN 10 28383445 missense possibly damaging 0.80
IGL01955:Ptprk APN 10 28595865 unclassified probably benign
IGL02263:Ptprk APN 10 28075114 missense unknown
IGL02489:Ptprk APN 10 28383472 missense probably damaging 1.00
IGL02697:Ptprk APN 10 28575618 missense possibly damaging 0.85
IGL02713:Ptprk APN 10 28592811 missense possibly damaging 0.92
IGL02943:Ptprk APN 10 28475176 missense possibly damaging 0.81
IGL03240:Ptprk APN 10 28492961 missense probably damaging 0.99
IGL03373:Ptprk APN 10 28566537 missense probably damaging 1.00
LCD18:Ptprk UTSW 10 28574987 intron probably benign
PIT4366001:Ptprk UTSW 10 28586019 missense probably benign
R0010:Ptprk UTSW 10 28585969 missense probably damaging 1.00
R0021:Ptprk UTSW 10 28592895 missense probably damaging 1.00
R0021:Ptprk UTSW 10 28592895 missense probably damaging 1.00
R0035:Ptprk UTSW 10 28263508 nonsense probably null
R0035:Ptprk UTSW 10 28263508 nonsense probably null
R0053:Ptprk UTSW 10 28475109 missense probably damaging 0.99
R0063:Ptprk UTSW 10 28263767 missense probably damaging 1.00
R0063:Ptprk UTSW 10 28263767 missense probably damaging 1.00
R0244:Ptprk UTSW 10 28206225 missense possibly damaging 0.79
R0281:Ptprk UTSW 10 28573392 missense probably damaging 1.00
R0387:Ptprk UTSW 10 28354629 missense possibly damaging 0.66
R0480:Ptprk UTSW 10 28585947 missense probably damaging 1.00
R0480:Ptprk UTSW 10 28585948 missense probably damaging 1.00
R0585:Ptprk UTSW 10 28575668 missense probably damaging 1.00
R0614:Ptprk UTSW 10 28075136 missense probably damaging 0.96
R0684:Ptprk UTSW 10 28483298 splice site probably benign
R1073:Ptprk UTSW 10 28496947 critical splice donor site probably null
R1377:Ptprk UTSW 10 28586026 missense probably benign 0.42
R1422:Ptprk UTSW 10 28475280 missense possibly damaging 0.64
R1482:Ptprk UTSW 10 28263516 missense probably benign 0.24
R1532:Ptprk UTSW 10 28585630 missense probably damaging 1.00
R1576:Ptprk UTSW 10 28551651 missense probably damaging 1.00
R1618:Ptprk UTSW 10 28493170 missense probably benign 0.00
R1654:Ptprk UTSW 10 28383647 missense probably damaging 1.00
R1701:Ptprk UTSW 10 28466058 missense probably damaging 1.00
R1747:Ptprk UTSW 10 28354692 missense possibly damaging 0.78
R2033:Ptprk UTSW 10 28592767 unclassified probably benign
R2059:Ptprk UTSW 10 28566603 missense probably damaging 1.00
R2076:Ptprk UTSW 10 28589368 missense probably damaging 0.98
R2164:Ptprk UTSW 10 28560142 missense probably damaging 1.00
R2260:Ptprk UTSW 10 28206149 missense possibly damaging 0.65
R2394:Ptprk UTSW 10 28551717 missense probably damaging 0.98
R2432:Ptprk UTSW 10 28592844 missense probably damaging 1.00
R2437:Ptprk UTSW 10 28354713 missense probably damaging 1.00
R2495:Ptprk UTSW 10 28475078 splice site probably benign
R3037:Ptprk UTSW 10 28580478 missense probably damaging 1.00
R3162:Ptprk UTSW 10 28592826 missense probably benign
R3162:Ptprk UTSW 10 28592826 missense probably benign
R3687:Ptprk UTSW 10 28473043 missense probably damaging 1.00
R3892:Ptprk UTSW 10 28263621 missense probably benign 0.02
R3963:Ptprk UTSW 10 28551665 missense probably damaging 0.99
R4077:Ptprk UTSW 10 28263512 missense probably benign
R4079:Ptprk UTSW 10 28263512 missense probably benign
R4112:Ptprk UTSW 10 28475288 critical splice donor site probably null
R4255:Ptprk UTSW 10 28206245 missense probably benign 0.14
R4523:Ptprk UTSW 10 28466052 missense probably damaging 0.99
R4651:Ptprk UTSW 10 28263690 missense probably damaging 0.99
R4652:Ptprk UTSW 10 28263690 missense probably damaging 0.99
R4828:Ptprk UTSW 10 28560054 missense probably damaging 1.00
R4829:Ptprk UTSW 10 28580484 nonsense probably null
R4883:Ptprk UTSW 10 28588932 missense probably damaging 1.00
R5004:Ptprk UTSW 10 28586063 missense possibly damaging 0.95
R5013:Ptprk UTSW 10 28551717 missense probably damaging 0.99
R5092:Ptprk UTSW 10 28592773 missense probably damaging 1.00
R5126:Ptprk UTSW 10 28575644 unclassified probably null
R5183:Ptprk UTSW 10 28475236 missense probably benign 0.02
R5264:Ptprk UTSW 10 28585586 missense probably damaging 1.00
R5304:Ptprk UTSW 10 28592054 splice site probably null
R5330:Ptprk UTSW 10 28587080 missense probably damaging 1.00
R5474:Ptprk UTSW 10 28496930 nonsense probably null
R5516:Ptprk UTSW 10 28496930 nonsense probably null
R5796:Ptprk UTSW 10 28383575 missense probably damaging 1.00
R5843:Ptprk UTSW 10 28493064 missense probably damaging 0.99
R5952:Ptprk UTSW 10 28585675 missense probably damaging 0.99
R6065:Ptprk UTSW 10 28475170 missense probably damaging 1.00
R6226:Ptprk UTSW 10 28564103 missense probably benign 0.02
R6264:Ptprk UTSW 10 28566673 missense probably damaging 1.00
R6638:Ptprk UTSW 10 28595811 missense probably damaging 1.00
R6843:Ptprk UTSW 10 28591982 missense possibly damaging 0.86
R6860:Ptprk UTSW 10 28334484 missense probably damaging 1.00
R6869:Ptprk UTSW 10 28473059 critical splice donor site probably null
R7214:Ptprk UTSW 10 28574909 missense probably benign 0.11
R7307:Ptprk UTSW 10 28589008 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTCTAGAACCACCTAGACCCATTG -3'
(R):5'- GGTCGAAATGTTGAATACCATGTG -3'

Sequencing Primer
(F):5'- ACCTAGACCCATTGCTCCTC -3'
(R):5'- AAATGTTGAATACCATGTGTGTGTG -3'
Posted On2015-01-23