Incidental Mutation 'R3722:Appl1'
ID 258987
Institutional Source Beutler Lab
Gene Symbol Appl1
Ensembl Gene ENSMUSG00000040760
Gene Name adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1
Synonyms 7330406P05Rik, 2900057D21Rik
MMRRC Submission 040713-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.187) question?
Stock # R3722 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 26640943-26692567 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 26649801 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 575 (T575M)
Ref Sequence ENSEMBL: ENSMUSP00000042875 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036570]
AlphaFold Q8K3H0
Predicted Effect probably damaging
Transcript: ENSMUST00000036570
AA Change: T575M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000042875
Gene: ENSMUSG00000040760
AA Change: T575M

DomainStartEndE-ValueType
Pfam:BAR_3 7 249 2.6e-66 PFAM
PH 278 377 1.4e-3 SMART
low complexity region 425 434 N/A INTRINSIC
Pfam:PID 501 632 6.6e-12 PFAM
low complexity region 645 660 N/A INTRINSIC
low complexity region 679 700 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223843
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has been shown to be involved in the regulation of cell proliferation, and in the crosstalk between the adiponectin signalling and insulin signalling pathways. The encoded protein binds many other proteins, including RAB5A, DCC, AKT2, PIK3CA, adiponectin receptors, and proteins of the NuRD/MeCP1 complex. This protein is found associated with endosomal membranes, but can be released by EGF and translocated to the nucleus. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased insulin-induced relaxation and increased insulin-induced ET-1-dependent vasoconstriction when fed a high fat diet. Homozygotes for a second null allele show increased hematocrit and T cell proliferation, and decreased fibroblast cell migration. Homozygotes for a third null allele show hyperactivity, increased body core temperature, and insulin resistance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb A T 10: 10,216,254 (GRCm39) S1485T probably benign Het
Akap9 A G 5: 4,120,351 (GRCm39) Y3589C probably damaging Het
Alkbh8 T C 9: 3,385,153 (GRCm39) Y482H probably damaging Het
Arhgap21 T C 2: 20,855,102 (GRCm39) E1420G probably damaging Het
Asic3 A T 5: 24,621,997 (GRCm39) Y419F probably benign Het
Atg7 A G 6: 114,672,624 (GRCm39) Y279C probably damaging Het
Braf G A 6: 39,600,610 (GRCm39) P616L probably damaging Het
Btnl2 T C 17: 34,577,109 (GRCm39) M88T possibly damaging Het
C1rb T A 6: 124,557,620 (GRCm39) Y586N probably damaging Het
Cacna1s T C 1: 135,996,780 (GRCm39) F127S possibly damaging Het
Cd47 A G 16: 49,688,205 (GRCm39) I42V probably benign Het
Cox8b T A 7: 140,478,918 (GRCm39) K66* probably null Het
Diras2 T A 13: 52,662,059 (GRCm39) I83F probably damaging Het
Dlg2 T A 7: 91,361,008 (GRCm39) probably null Het
Dnah8 G A 17: 31,073,872 (GRCm39) R4514H probably damaging Het
Dnai1 G A 4: 41,602,615 (GRCm39) R113H probably damaging Het
Dolpp1 T C 2: 30,287,500 (GRCm39) L204P probably damaging Het
Fam170a C T 18: 50,415,271 (GRCm39) P306S probably benign Het
Fbxl12 A T 9: 20,550,268 (GRCm39) probably null Het
Fndc3a T A 14: 72,777,648 (GRCm39) I1186F probably benign Het
Gm12886 T A 4: 121,274,667 (GRCm39) D71V probably damaging Het
H3c8 T C 13: 23,719,722 (GRCm39) V36A possibly damaging Het
Ica1 A G 6: 8,659,021 (GRCm39) probably benign Het
Ighv8-11 A G 12: 115,530,771 (GRCm39) I119T possibly damaging Het
Ism1 A T 2: 139,573,931 (GRCm39) R94* probably null Het
Kbtbd11 T A 8: 15,079,118 (GRCm39) C572* probably null Het
Kcnk15 T C 2: 163,700,214 (GRCm39) L132P probably damaging Het
Lrmda T A 14: 22,077,399 (GRCm39) probably benign Het
Mei1 A G 15: 81,987,405 (GRCm39) H399R possibly damaging Het
Mrtfb C T 16: 13,203,557 (GRCm39) A201V probably damaging Het
Ncstn G A 1: 171,895,462 (GRCm39) T562M possibly damaging Het
Nudt4 A T 10: 95,385,367 (GRCm39) probably null Het
Omp T C 7: 97,794,420 (GRCm39) N69S probably benign Het
Or10d3 A C 9: 39,461,418 (GRCm39) C250G probably damaging Het
Or4a75 A T 2: 89,448,503 (GRCm39) I11N possibly damaging Het
Pak1 C T 7: 97,503,704 (GRCm39) P13L probably damaging Het
Pde4d T A 13: 110,087,866 (GRCm39) C744* probably null Het
Pelp1 T C 11: 70,289,026 (GRCm39) Y240C possibly damaging Het
Pou2f1 G C 1: 165,722,538 (GRCm39) P349R probably damaging Het
Ptprk A G 10: 28,259,619 (GRCm39) D353G probably damaging Het
Ptprs A G 17: 56,724,485 (GRCm39) F1152S probably damaging Het
Rnf135 G T 11: 80,087,743 (GRCm39) A231S probably benign Het
Rpn1 G A 6: 88,067,282 (GRCm39) probably null Het
Rreb1 T A 13: 38,131,074 (GRCm39) D1409E probably benign Het
Sipa1l2 G A 8: 126,200,323 (GRCm39) H668Y probably damaging Het
Slc35a5 A T 16: 44,967,685 (GRCm39) I138N probably damaging Het
Slc35d1 T C 4: 103,065,321 (GRCm39) K187E possibly damaging Het
Slc44a2 A T 9: 21,254,273 (GRCm39) I212F possibly damaging Het
Slc7a1 G A 5: 148,272,343 (GRCm39) R445* probably null Het
Snapc4 A G 2: 26,255,440 (GRCm39) L1028P probably benign Het
Snrnp40 C T 4: 130,262,068 (GRCm39) T152I possibly damaging Het
Spata31f1a T C 4: 42,851,472 (GRCm39) E228G probably benign Het
Spink4 T A 4: 40,929,136 (GRCm39) C54S probably damaging Het
Tex2 C T 11: 106,437,566 (GRCm39) W203* probably null Het
Tmcc1 T C 6: 116,110,783 (GRCm39) E170G possibly damaging Het
Ttc23l CT CTTGGATT 15: 10,537,648 (GRCm39) probably benign Het
Ttc23l G A 15: 10,537,652 (GRCm39) S206L probably benign Het
Ttll6 A G 11: 96,024,747 (GRCm39) N46D probably benign Het
Txk T A 5: 72,865,078 (GRCm39) K266* probably null Het
Uggt2 T C 14: 119,278,930 (GRCm39) E859G probably damaging Het
Uros A T 7: 133,304,120 (GRCm39) M1K probably null Het
Vps13b T A 15: 35,671,528 (GRCm39) I1677N probably damaging Het
Zbtb5 A G 4: 44,994,863 (GRCm39) probably null Het
Zfp760 A G 17: 21,941,143 (GRCm39) Y106C probably damaging Het
Other mutations in Appl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01013:Appl1 APN 14 26,671,433 (GRCm39) missense possibly damaging 0.89
IGL01615:Appl1 APN 14 26,681,427 (GRCm39) splice site probably benign
IGL01633:Appl1 APN 14 26,684,795 (GRCm39) missense probably damaging 0.99
IGL01945:Appl1 APN 14 26,650,612 (GRCm39) missense possibly damaging 0.80
IGL02210:Appl1 APN 14 26,647,909 (GRCm39) splice site probably benign
IGL02650:Appl1 APN 14 26,672,665 (GRCm39) missense possibly damaging 0.76
IGL02674:Appl1 APN 14 26,671,418 (GRCm39) missense possibly damaging 0.86
IGL02803:Appl1 APN 14 26,673,473 (GRCm39) missense possibly damaging 0.93
R0129:Appl1 UTSW 14 26,650,600 (GRCm39) missense probably damaging 1.00
R0183:Appl1 UTSW 14 26,684,811 (GRCm39) missense probably damaging 1.00
R0323:Appl1 UTSW 14 26,664,695 (GRCm39) missense possibly damaging 0.91
R0411:Appl1 UTSW 14 26,662,213 (GRCm39) missense probably benign
R1213:Appl1 UTSW 14 26,665,950 (GRCm39) missense probably benign 0.27
R1277:Appl1 UTSW 14 26,649,813 (GRCm39) missense possibly damaging 0.87
R1668:Appl1 UTSW 14 26,645,811 (GRCm39) missense probably damaging 1.00
R1856:Appl1 UTSW 14 26,649,706 (GRCm39) missense probably damaging 1.00
R1889:Appl1 UTSW 14 26,647,470 (GRCm39) splice site probably benign
R2145:Appl1 UTSW 14 26,671,576 (GRCm39) missense possibly damaging 0.66
R3720:Appl1 UTSW 14 26,649,801 (GRCm39) missense probably damaging 1.00
R3917:Appl1 UTSW 14 26,650,561 (GRCm39) missense probably damaging 1.00
R4700:Appl1 UTSW 14 26,647,928 (GRCm39) missense probably benign 0.00
R5139:Appl1 UTSW 14 26,669,112 (GRCm39) missense probably benign 0.04
R5485:Appl1 UTSW 14 26,684,823 (GRCm39) missense probably damaging 1.00
R5536:Appl1 UTSW 14 26,645,737 (GRCm39) nonsense probably null
R5795:Appl1 UTSW 14 26,664,773 (GRCm39) missense probably benign 0.01
R7044:Appl1 UTSW 14 26,650,634 (GRCm39) missense possibly damaging 0.90
R7318:Appl1 UTSW 14 26,685,617 (GRCm39) missense probably benign 0.01
R7447:Appl1 UTSW 14 26,681,409 (GRCm39) nonsense probably null
R7943:Appl1 UTSW 14 26,667,525 (GRCm39) missense probably benign 0.01
R8110:Appl1 UTSW 14 26,649,751 (GRCm39) nonsense probably null
R8129:Appl1 UTSW 14 26,671,466 (GRCm39) missense possibly damaging 0.87
R8160:Appl1 UTSW 14 26,650,592 (GRCm39) missense probably benign 0.35
R8211:Appl1 UTSW 14 26,667,555 (GRCm39) missense probably benign 0.18
R8239:Appl1 UTSW 14 26,686,914 (GRCm39) missense probably damaging 0.99
R8379:Appl1 UTSW 14 26,647,372 (GRCm39) critical splice donor site probably null
R8464:Appl1 UTSW 14 26,674,985 (GRCm39) nonsense probably null
R8699:Appl1 UTSW 14 26,662,212 (GRCm39) missense probably benign
R9023:Appl1 UTSW 14 26,685,652 (GRCm39) missense possibly damaging 0.93
R9090:Appl1 UTSW 14 26,669,084 (GRCm39) missense probably benign 0.01
R9203:Appl1 UTSW 14 26,682,970 (GRCm39) nonsense probably null
R9227:Appl1 UTSW 14 26,645,692 (GRCm39) missense unknown
R9230:Appl1 UTSW 14 26,645,692 (GRCm39) missense unknown
R9243:Appl1 UTSW 14 26,649,710 (GRCm39) missense possibly damaging 0.62
R9271:Appl1 UTSW 14 26,669,084 (GRCm39) missense probably benign 0.01
R9378:Appl1 UTSW 14 26,649,784 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCGTAATCGGAGAGCTTTTCC -3'
(R):5'- CCCTAGAGAGTTTATGCACCAAAGG -3'

Sequencing Primer
(F):5'- GGAGAGCTTTTCCCAGAAATTTAAGG -3'
(R):5'- GTTTATGCACCAAAGGAATTAGCAG -3'
Posted On 2015-01-23